In part II of this lab, the objective is to transcribe a sequence of DNA into RNA using the Y chromosome. Then we are to translate RNA into 10 amino acids of a polypeptide, as well as build a model of the DNA molecule with those 10 amino acids represented. Just to give you a little background: The Y chromosome is one of the sex chromosomes, the other being X. (Females have two XX chromosomes and a male has an X and a Y chromosome). DNA, or deoxyribonucleic acid, is the genetic material that directs everything a cell does. It is considered the key to life itself. RNA, or ribonucleic acid, is basically the messenger for DNA, responsible for carrying out DNA's instructions, and in some cases, regulating DNA. Proteins are created from 20 different amino acids and a string of 3-100 amino acids in considered a polypeptide.
To understand how to "crack" the code of translation from DNA to RNA, you need a basic understanding of what DNA consists of. DNA is a double helix and consists of a sugar group, a phosphate group, and one of four bases - adenine, thymine, guanine or cytosine. The double helix is formed as the bases pair up, thymine with adenine, and guanine with cytosine. RNA is a single strand, so that only one of the two DNA strands actually carries the genetic code for synthesis of RNA. One of the base pairs of RNA is different from DNA - thymine is uracil in RNA. And the sugar group for RNA is ribose rather than deoxyribose of DNA.
A portion of the DNA molecule, representing a single gene, unwinds temporarily and a complementary strand of RNA is produced from the DNA strand. This process takes place in the nucleus. The RNA molecule that is produced is called messenger RNA or mRNA because it contains a template that can be translated into a specific sequence of amino acids that make up a particular protein. This message is encrypted as a triplet code or codon, because three bases make up one of 20 different amino acids.
 |
| Preliminary drawing of DNA strand |
To build my model of the DNA strand, I used jewelry beads and chain. My first step after translating my RNA to amino acids, was to draw it on paper to get a better feel for what I needed to do. Then I took my chain and formed it into a double helix. I took 30 headpins and placed them through the chain to anchor them. I color coded my base pairs as follow:
 |
| Beginning the process of DNA |
C or Cytosine = purple seed beads
G or guanine = silver seed beads
T or thymine = green seed beads
A or adenine = red seed beads
 | ||
| In process of creating DNA |
I also used tube beads to represent the hydrogen bond between the base pairings. Hydrogen bonds hold the pairs together, like glue. I placed my beads on the headpins, following my code of DNA and secured my headpin on the other side of my helix (chain).
 |
| Closeup of DNA strand |
 |
| Complete DNA strand |
The following was my original DNA strand from the Y chromosome:
CCTTCCTCTCTCTCTCTCTCTCTCTCTCTCTCTCCTGACTTTCTGTCTCTTCCTCTGTCTCTCTGTTTCT
We were only asked to translate the first 10 codons. It is easier to see if you put a space between every three bases.
CCT TCC TCT CTC TCT CTC TCT CTC TCT CTC
Next, we translate this to RNA: Remember that C and G are paired and T and A are paired. And any T (thymine) will now be uracil or U.
GGA AGG AGA GAG AGA GAG AGA GAG AGA GAG
In my particular strand of DNA, you will notice there are no U's. Uracil did not occur until later in my strand.
Next, I translated my RNA into my ten amino acids using the chart on page 412 of our textbook:
1 - glycine (Gly)
2 - argenine (Arg)
3 - argenine (Arg)
4 - glutamic acid (Glu)
5 - argenine (Arg)
6 - glutamic acid (Glu)
7 - argenine (Arg)
8 - glutamic acid (Glu)
9 - argenine (Arg)
10 - glutamic acid (Glu)
The model represents the first 10 base pairs of a DNA strand from a Y chromosome. This was actually a very enlightening experience.
After doing some research, I began to understand a little bit more about the process of forming a protein.
The Central Dogma in molecular biology states that DNA is transcribed into RNA, which is transcribed into protein.
Protein is never back-translated into DNA or RNA. And except for retroviruses, DNA is never created from RNA. And
DNA is never translated to protein. There is a very specific transfer process of sequential information.
Sources:
DNAi.org
Human Biology, 6th Edition, Michael D. Johnson
cnx.org
wikipedia.org
And many thanks to faculty.yc.edu/lfrolich for this wonderful website.
And to Nina, for pointing me in the right direction.
No comments:
Post a Comment