tag:blogger.com,1999:blog-77815824374177067652024-02-20T13:04:39.224-08:00My Class BlogVickihttp://www.blogger.com/profile/06412364992060613157noreply@blogger.comBlogger9125tag:blogger.com,1999:blog-7781582437417706765.post-22759205672411602172012-05-08T20:58:00.001-07:002012-05-08T20:58:33.223-07:00<style>
@font-face {
font-family: "Times New Roman";
}@font-face {
font-family: "Courier New";
}@font-face {
font-family: "Wingdings";
}@font-face {
font-family: "Apple Chancery";
}@font-face {
font-family: "Arial Rounded MT Bold";
}@font-face {
font-family: "Baskerville";
}@font-face {
font-family: "Bauhaus 93";
}@font-face {
font-family: "Bodoni SvtyTwo ITC TT-Bold";
}@font-face {
font-family: "Capitals";
}@font-face {
font-family: "Century Gothic";
}p.MsoNormal, li.MsoNormal, div.MsoNormal { margin: 0in 0in 0.0001pt; font-size: 12pt; font-family: "Times New Roman"; }table.MsoNormalTable { font-size: 10pt; font-family: "Times New Roman"; }div.Section1 { page: Section1; }ol { margin-bottom: 0in; }ul { margin-bottom: 0in; }
</style>
<br />
<div class="MsoNormal" style="margin-left: 1in; text-indent: 0.5in;">
<span style="color: maroon; font-family: "Bodoni SvtyTwo ITC TT-Bold"; font-size: 24pt;"><b><i>B</i></b></span><span style="color: #ff6600; font-family: "Apple Chancery"; font-size: 24pt;"><b><i>i</i></b></span><span style="color: purple; font-size: 24pt;"><b><i>o</i></b></span><span style="color: cyan; font-family: Baskerville; font-size: 24pt;"><b><i>d</i></b></span><span style="color: magenta; font-size: 24pt;"><b><i>i</i></b></span><span style="color: green; font-family: "Bauhaus 93"; font-size: 24pt;"><b><i>v</i></b></span><span style="color: #993300; font-family: "Century Gothic"; font-size: 24pt;"><b><i>e</i></b></span><span style="color: red; font-size: 24pt;"><b><i>r</i></b></span><span style="color: yellow; font-family: Capitals; font-size: 24pt;"><b><i>s</i></b></span><span style="color: maroon; font-size: 24pt;"><b><i>i</i></b></span><span style="color: #333300; font-family: "Arial Rounded MT Bold"; font-size: 24pt;"><b><i>t</i></b></span><span style="color: grey; font-size: 24pt;"><b><i>y</i></b></span><span style="font-size: 20pt;"><b><i> Lab Project</i></b></span></div>
<div class="MsoNormal" style="margin-left: 1in; text-indent: 0.5in;">
<i><span> </span><span> </span><span> </span></i><span style="font-size: 14pt; font-style: normal;">V Grove</span></div>
<div class="MsoNormal" style="margin-left: 1in; text-indent: 0.5in;">
<br /></div>
<div class="MsoNormal" style="margin-left: 1in; text-indent: 0.5in;">
<br /></div>
<div class="MsoNormal" style="margin-left: 0.5in; text-indent: -0.5in;">
<span> </span>In
this lab project, I will discuss my findings on the characteristics of global
biodiversity hotspots and identify endangered species in the area I have chosen
(which is Madagascar). I will also try to convey some of the effects of human
activity on biodiversity and why it is critical both for the people that abide
everywhere on this planet to be aware of what we are doing and how it affects
things. </div>
<div class="MsoNormal" style="margin-left: 0.5in; text-indent: -0.5in;">
<br /></div>
<div class="MsoNormal" style="margin-left: 0.5in; text-indent: -0.5in;">
<span> </span>First,
let me begin by explaining biodiversity hotspots. These are areas that have
been identified as areas that are in need because of rapid decline of
extinction, both in animals and plants, endemic to that area. There are two
strict criteria that have to be met, in order to be considered a hotspot. One,
the area must contain at least 1500 species of vascular plants that are endemic
(indigenous) to that area, and Two, the area has experienced a loss of at least
70% of its original habitat. </div>
<div class="MsoNormal" style="margin-left: 0.5in; text-indent: -0.5in;">
<br /></div>
<table align="center" cellpadding="0" cellspacing="0" class="tr-caption-container" style="margin-left: auto; margin-right: auto; text-align: center;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhAsCT9B03uh5AcQM47CtGEMtYMw59fUe1mqGdbuYYb3a9CjG8Q5khZd3K_8uPDblRSA4Z1MahcZoI_0ddnDqMoCWDxmPUHZTKO8YM15d8Qj4S1kFjjMrCRDdgPVeKw0qWFwgJwRuaDjtNQ/s1600/Madisland" imageanchor="1" style="margin-left: auto; margin-right: auto;"><img border="0" height="209" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhAsCT9B03uh5AcQM47CtGEMtYMw59fUe1mqGdbuYYb3a9CjG8Q5khZd3K_8uPDblRSA4Z1MahcZoI_0ddnDqMoCWDxmPUHZTKO8YM15d8Qj4S1kFjjMrCRDdgPVeKw0qWFwgJwRuaDjtNQ/s320/Madisland" width="320" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Madagascar Island/virutaltripping.com/accessed 5/8/12</td></tr>
</tbody></table>
<div class="MsoNormal" style="margin-left: 0.5in; text-indent: -0.5in;">
<span> </span>Now,
about Madagascar… Madagascar is off the east coast of Africa. It is isolated
from the rest of the continent. It has quite the variety of ecosystems. There
are many wetlands: lakes, marshes, swamps and lagoons. There are several moist
forests: the lowland rainforests, coastal rainforests, cloud forest, Montane
rainforest, Sambirano forest, etc… Then there are the spiny forest, grasslands,
mangrove forest, and the list goes on and on.<span> </span></div>
<div class="MsoNormal" style="margin-left: 0.5in; text-indent: -0.5in;">
<br /></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhSNAQfoe4hrbnnjR2q8X0nH0wWbztGghU4QEkiWzPbZG3eXePqSbaVocY0zr1Lqr3HhGUVOUvOzUYrng_pzunCsIn6od1_j63mQB-yW3l3B-7UpaSae9jYoiud8vGoxEmzx63H0K3p6U6l/s1600/baobabs" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="171" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhSNAQfoe4hrbnnjR2q8X0nH0wWbztGghU4QEkiWzPbZG3eXePqSbaVocY0zr1Lqr3HhGUVOUvOzUYrng_pzunCsIn6od1_j63mQB-yW3l3B-7UpaSae9jYoiud8vGoxEmzx63H0K3p6U6l/s320/baobabs" width="320" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Baobabs/bingfotos.blogspot.com/accessed 5/8/12</td></tr>
</tbody></table>
<div class="MsoNormal" style="margin-left: 0.5in; text-indent: -0.5in;">
<span> </span>There
are 13,000 plant species between Madagascar and the Indian Ocean Islands and
11,600 of those are endemic to the area. That is approximately 3.9% of the
worlds total. In the plant kingdom, 6 of the worlds 8 species of baobabs are
endemic. There are 40 endemic species of aloe and 850 endemic species of
orchid.<span> </span>In the animal kingdom,
approximately 75% of the species found there live nowhere else in the world.
The lemur is at the top of the list, with over 101 species and subspecies
formally recognized in 2010, eight of which are in the critically endangered
category. And many more are approaching this level. To back up, the lemur is a
primate, classification prosimian. They are the oldest living primate in the
world, dating back 65 million years.<span>
</span></div>
<div class="MsoNormal" style="margin-left: 0.5in; text-indent: -0.5in;">
<br /></div>
<div class="separator" style="clear: both; text-align: center;">
</div>
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiw9ys5T-2ZTahvO_kUXu1rLNBSuzHAU_HXEAdq1JLdQJwWRQTyHPynKgVT82C7sApMys5UbstSyqWg43R6FvuKOUNdK4v-1NDXY0y3sf4YokQXPe-T1fb6sDBskiW2-1JxYd2U51SSjEHa/s1600/deforestationaerial+" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><br /></a></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiw9ys5T-2ZTahvO_kUXu1rLNBSuzHAU_HXEAdq1JLdQJwWRQTyHPynKgVT82C7sApMys5UbstSyqWg43R6FvuKOUNdK4v-1NDXY0y3sf4YokQXPe-T1fb6sDBskiW2-1JxYd2U51SSjEHa/s1600/deforestationaerial+" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="300" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiw9ys5T-2ZTahvO_kUXu1rLNBSuzHAU_HXEAdq1JLdQJwWRQTyHPynKgVT82C7sApMys5UbstSyqWg43R6FvuKOUNdK4v-1NDXY0y3sf4YokQXPe-T1fb6sDBskiW2-1JxYd2U51SSjEHa/s400/deforestationaerial+" width="400" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Deforestation/photos.wildmadagascar.org/accessed 5/8/12</td></tr>
</tbody></table>
<div class="MsoNormal" style="margin-left: 0.5in; text-indent: -0.5in;">
<span> </span>As
you can see from some of the above numbers, Madagascar has met one of the
criteria for being considered a hotspot. Now for the kicker.., experts are
saying that the island has already lost 90% of its original forest cover! This
is the main reason for the biodiversity decline – deforestation. </div>
<div class="MsoNormal" style="margin-left: 0.5in; text-indent: -0.5in;">
<br /></div>
<div class="MsoNormal" style="margin-left: 0.5in; text-indent: -0.5in;">
<span> </span>The
Malagasy people, about 17 million, are very diverse themselves. A mix of<span> </span>Malayo-Indonesians and African-Arabs.
With British and French mixed in as well. Due to the island being along a major
trade route, there have been numerous attempts at colonization. In 1794, the
tribes were united, with a single monarchy. In 1820, Britain recognized it as independent.
The French then invaded in 1895, and in 1947 there was a revolt that was
brutally squashed. By the 1950’s, political parties took shape and in 1960
there was a peaceful transition to independence. That might have been the only
time for anything peaceful. There has been incredible turmoil politically and
economically in the last<span> </span>several
decades, with outbreaks of civil war.<span>
</span></div>
<div class="MsoNormal" style="margin-left: 0.5in; text-indent: -0.5in;">
<br /></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgBFxrzm7aoRFqXpQJVFTJUWw2wJajsL4GqQcPot9NAfA-ogMmKuQNf1G7Lwk4tju2vZlzRbgxO8GslMlmPL2mm2wSxS3UaLzxRxMz-GHmHAlggWp0FzoqbU5kkIbG1uImbNDCz94Qfwjhs/s1600/poverty" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="180" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgBFxrzm7aoRFqXpQJVFTJUWw2wJajsL4GqQcPot9NAfA-ogMmKuQNf1G7Lwk4tju2vZlzRbgxO8GslMlmPL2mm2wSxS3UaLzxRxMz-GHmHAlggWp0FzoqbU5kkIbG1uImbNDCz94Qfwjhs/s320/poverty" width="320" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">poverty/besorongola.wordpress.com/accessed 5/8/12</td></tr>
</tbody></table>
<div class="MsoNormal" style="margin-left: 0.5in; text-indent: -0.5in;">
<span> </span>There
is extreme poverty in rural areas, although, when President Ravalomanana was in
power, he instituted some broad civil reforms: democratization, economic
liberalization, improved healthcare, road and schools and some bold steps
towards modernization and safe guarding biodiversity. There are still many or
the people that live close to the land, however. A mix of old and new.</div>
<div class="MsoNormal" style="margin-left: 0.5in; text-indent: -0.5in;">
<br /></div>
<div class="MsoNormal" style="margin-left: 0.5in; text-indent: -0.5in;">
<span> </span>It
is because of war and poverty that Madagascar is in the trouble it is in, with
the decline of biodiversity. The biggest number one contributor to this decline
being what is called “slash and burn agriculture”, in rural areas, by
impoverished farmers. Other factors that have contributed include lack of
access to family planning and reproductive healthcare, high fertility rates and
minimal education levels. </div>
<div class="MsoNormal" style="margin-left: 0.5in; text-indent: -0.5in;">
<br /></div>
<div class="MsoNormal" style="margin-left: 0.5in; text-indent: -0.5in;">
<span> </span>Now,
is it important to be concerned about species extinction? The answer to that is
yes, it is. When a species becomes extinct, it has a domino effect. So when one
is wiped out, it affects another species and so on. Eventually, it affects our
own human species with loss of homes, food, and even culture. Loss of species
also affects health. Many of our medicines have been discovered first in the
rainforests of the world. As these forests disappear, so does our ability to
fight present and future disease. </div>
<div class="MsoNormal" style="margin-left: 0.5in; text-indent: -0.5in;">
<br /></div>
<table align="center" cellpadding="0" cellspacing="0" class="tr-caption-container" style="margin-left: auto; margin-right: auto; text-align: center;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjliV05nefGKSEToB66_XhPY7eXyrsOaFrl6167-NCuKFJwFvs4C-D1-B-v8lKzO4o9g9gRzD3-ydM1FGPVOdmNfsaQE7eCcZMSFYCKsPV-q-V8pllDEZel03plL4hKtbHFLoIa2u0YGqLK/s1600/GoldenBambooLemur" imageanchor="1" style="margin-left: auto; margin-right: auto;"><img border="0" height="241" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjliV05nefGKSEToB66_XhPY7eXyrsOaFrl6167-NCuKFJwFvs4C-D1-B-v8lKzO4o9g9gRzD3-ydM1FGPVOdmNfsaQE7eCcZMSFYCKsPV-q-V8pllDEZel03plL4hKtbHFLoIa2u0YGqLK/s320/GoldenBambooLemur" width="320" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Golden Bamboo Lemur/antpitta.com/accessed 5/8/12</td></tr>
</tbody></table>
<div class="MsoNormal" style="margin-left: 0.5in; text-indent: -0.5in;">
<span> </span>Madagascar
is considered the world’s highest primate conservation priority. At the top of
the list of critically endangered species in Madagascar, is the golden bamboo
lemur. To help in the fight to preserve this and many other species, the
Greater Bamboo Lemur Conservation Project and Saving Species teamed up. </div>
<div class="MsoNormal" style="margin-left: 0.5in; text-indent: -0.5in;">
<br /></div>
<ul style="margin-top: 0in;" type="disc"><ul style="margin-top: 0in;" type="circle">
<li class="MsoNormal">They
have restored critical habitat. In 2009, they planted a total of 476
saplings (19 species). </li>
<li class="MsoNormal">They
continued reforestation in 2010. </li>
<li class="MsoNormal">They
employed locals for fire prevention. </li>
<li class="MsoNormal">Set
conservation boundaries – this is the essential first step to long term
lease of the government to manage this land. </li>
<li class="MsoNormal">Inspired
local people – the success of existing plantations has inspired local
land owners to step forward, offering additional plots of land for future
planting.</li>
</ul>
</ul>
<div class="MsoNormal" style="margin-left: 0.5in; text-indent: -0.5in;">
<span> </span><span> </span></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj8Q32v3ra6QH9A_Y93PXhAD3RujWWd-hJaYoR0r9IlLWCMqAH_DTOsctUqzfC5w6ndiJQ691pBkfme8bNXnjKOsz5Nz9qs9z-RGy8G5z8Lp_uinDZz4rR5ul_MoDGrhBcYidqaPMM8qETR/s1600/Nationalpark" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="240" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj8Q32v3ra6QH9A_Y93PXhAD3RujWWd-hJaYoR0r9IlLWCMqAH_DTOsctUqzfC5w6ndiJQ691pBkfme8bNXnjKOsz5Nz9qs9z-RGy8G5z8Lp_uinDZz4rR5ul_MoDGrhBcYidqaPMM8qETR/s320/Nationalpark" width="320" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Ranomafana Ntl. Park/rxx.co.il/accessed 5/8/12</td></tr>
</tbody></table>
<div class="MsoNormal" style="margin-left: 0.5in; text-indent: -0.5in;">
<span> </span>Some
of the other efforts of the government include the establishment of two
National Parks, improving healthcare and family planning, and enabling
communities to manage forest resources – establishing fish ponds, vegetable
gardens, and fruit tree nurseries. Saving Species has helped to develop 40
community management plans, and worked with over 60 community groups, all with
conservation and development goals, to become legal institutions. </div>
<div class="MsoNormal" style="margin-left: 0.5in; text-indent: -0.5in;">
<br /></div>
<div class="MsoNormal" style="margin-left: 0.5in; text-indent: -0.5in;">
<span> </span>To
the question, should I be concerned, even with hotspots in far away places? Of
course, the answer is yes. We have always had extinction of species,
approximately 1-5 species per year. But now, because of our own species and our
activities, that rate has accelerated more than ever before with 10,000 –
25,000 becoming extinct every year. That is dozens per day. Living organisms
play a vital role with major elements: carbon, nitrogen, etc…, as well as water
in the environment. Everything works together, requiring numerous species, all
interacting. It is the variety of genes, species, biological communities and
their life-sustaining processes that give us food, water, energy, fibers, raw
materials, industrial chemicals, and medicines. And all of this pours billions
of dollars into the world economy. What happens when we have used up all of our
resources? The answer is, we die. We become extinct. That is what I have
learned from this project. And we take everything else down with us. As a
species, we have to become more proactive in this fight to save our planet. The
survival of future generations depends on it.<span> </span></div>
<div class="MsoNormal" style="margin-left: 0.5in; text-indent: -0.5in;">
<br /></div>
<div class="MsoNormal" style="margin-left: 0.5in; text-indent: -0.5in;">
<span> </span></div>
<div class="MsoNormal" style="margin-left: 0.5in;">
<b>Sources: </b></div>
<div class="MsoNormal" style="margin-left: 0.5in;">
Wildmadagascar,org</div>
<div class="MsoNormal" style="margin-left: 0.5in;">
Naturetrek.co.uk/tour</div>
<div class="MsoNormal" style="margin-left: 0.5in;">
Library.thinkquest.org</div>
<div class="MsoNormal" style="margin-left: 0.5in;">
Infoplease.com</div>
<div class="MsoNormal" style="margin-left: 0.5in;">
Biodiversity.module.pdf</div>
<div class="MsoNormal" style="margin-left: 0.5in;">
Savingspecies.org</div>
<div class="MsoNormal" style="margin-left: 0.5in;">
Animalinfo.org</div>Vickihttp://www.blogger.com/profile/06412364992060613157noreply@blogger.com0tag:blogger.com,1999:blog-7781582437417706765.post-68777695285985205852012-05-07T19:55:00.001-07:002012-05-07T19:55:28.368-07:00HUMAN BIOLOGY/COMPILATION 4<style>
@font-face {
font-family: "Times New Roman";
}@font-face {
font-family: "Courier New";
}@font-face {
font-family: "Wingdings";
}p.MsoNormal, li.MsoNormal, div.MsoNormal { margin: 0in 0in 0.0001pt; font-size: 12pt; font-family: "Times New Roman"; }table.MsoNormalTable { font-size: 10pt; font-family: "Times New Roman"; }div.Section1 { page: Section1; }ol { margin-bottom: 0in; }ul { margin-bottom: 0in; }
</style>
<br />
<div class="MsoNormal">
<span style="font-size: 16pt;"><b>TABLE OF CONTENTS</b></span></div>
<div class="MsoNormal">
<br /></div>
<div class="separator" style="clear: both; text-align: center;">
</div>
<div class="MsoNormal">
<span style="font-size: 16pt;"><b>The Digestive System and
Nutrition</b></span></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>The Digestive System
Brings Nutrients into the Body</b></span></div>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc"><ul style="margin-top: 0in;" type="circle">
<li class="MsoNormal"><b>The
walls of the GI tract are composed of four layers</b></li>
<li class="MsoNormal"><b>Five
basic processes accomplish digestive system function</b></li>
<li class="MsoNormal"><b>Two
types of motility aid digestive processes</b></li>
</ul>
</ul>
<div class="MsoNormal">
</div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>The Mouth Processes Food
for Swallowing</b></span></div>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc"><ul style="margin-top: 0in;" type="circle">
<li class="MsoNormal"><b>Teeth
bite and chew food</b></li>
<li class="MsoNormal"><b>The
tongue positions and tastes food</b></li>
<li class="MsoNormal"><b>Saliva
begins the process of digestion</b></li>
</ul>
</ul>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>The Pharynx and Esophagus
Deliver Food to the Stomach</b></span></div>
<div class="MsoNormal">
</div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>The Stomach Stores Food,
Digests Protein, and Regulates Delivery</b></span></div>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc"><ul style="margin-top: 0in;" type="circle">
<li class="MsoNormal"><b>Gastric
juice breaks down proteins</b></li>
<li class="MsoNormal"><b>Stomach
contractions mix food and push it forward</b></li>
</ul>
</ul>
<div class="MsoNormal">
</div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>The Small Intestine
Digests Food and Absorbs Nutrients and Water</b></span></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Accessory Organs Aid
Digestions and Absorption</b></span></div>
<div class="MsoNormal">
</div>
<ul style="margin-top: 0in;" type="disc"><ul style="margin-top: 0in;" type="circle">
<li class="MsoNormal"><b>The
pancreas secretes enzymes and NaHCO3</b></li>
<li class="MsoNormal"><b>The
liver produces bile and performs many other functions</b></li>
<li class="MsoNormal"><b>The
gallbladder stores bile until needed </b></li>
</ul>
</ul>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>The Large Intestine
Absorbs Nutrients and Eliminates Wastes</b></span></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>How Nutrients are Absorbed</b></span></div>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc"><ul style="margin-top: 0in;" type="circle">
<li class="MsoNormal"><b>Proteins
and carbohydrates are absorbed by active transport</b></li>
<li class="MsoNormal"><b>Lipids
are broken down, then reassembled</b></li>
<li class="MsoNormal"><b>Water
is absorbed by osmosis</b></li>
<li class="MsoNormal"><b>Vitamins
and minerals follow a variety of paths</b></li>
</ul>
</ul>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Endocrine and Nervous
Systems Regulate Digestion</b></span></div>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc"><ul style="margin-top: 0in;" type="circle">
<li class="MsoNormal"><b>Regulation
depends on volume and content of food</b></li>
<li class="MsoNormal"><b>Nutrients
are used or stored until needed</b></li>
</ul>
</ul>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Nutrition: You Are What
You Eat</b></span></div>
<div class="MsoNormal">
</div>
<ul style="margin-top: 0in;" type="disc"><ul style="margin-top: 0in;" type="circle">
<li class="MsoNormal"><b>MyPyramid
plan offers a personalized approach</b></li>
<li class="MsoNormal"><b>Carbohydrates:
a major energy source</b></li>
<li class="MsoNormal"><b>Lipids:
essential cell components and energy sources</b></li>
<li class="MsoNormal"><b>Complete
proteins contain every amino acid</b></li>
<li class="MsoNormal"><b>Vitamins
are essential for normal function</b></li>
<li class="MsoNormal"><b>Minerals:
elements essential for body processes</b></li>
<li class="MsoNormal"><b>Fiber
benefits the colon</b></li>
</ul>
</ul>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Weight Control: Energy
Consumed Versus Energy Spent</b></span></div>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc"><ul style="margin-top: 0in;" type="circle">
<li class="MsoNormal"><b>BMR:
determining how many Calories we need</b></li>
<li class="MsoNormal"><b>Energy
balance and body weight</b></li>
<li class="MsoNormal"><b>Physical
activity: an efficient way to use Calories</b></li>
<li class="MsoNormal"><b>Healthy
weight improves overall health</b></li>
</ul>
</ul>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Disorders of the Digestive
System</b></span></div>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc"><ul style="margin-top: 0in;" type="circle">
<li class="MsoNormal"><b>Disorders
of the GI tract</b></li>
<li class="MsoNormal"><b>Disorders
of the accessory organs</b></li>
<li class="MsoNormal"><b>Malnutrition:
too many or too few nutrients</b></li>
<li class="MsoNormal"><b>Obesity:
a worldwide epidemic?</b></li>
</ul>
</ul>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Eating Disorders: Anorexia
Nervosa and Bulimia</b></span></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
</div>
<div class="MsoNormal">
<span style="font-size: 16pt;"><b>The Nervous System:
Integration and Control</b></span></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>The Nervous System has Two
Principal Parts</b></span></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Neurons are the
Communication Cells of the Nervous System</b></span></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Neurons Initiate Action
Potentials</b></span></div>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc"><ul style="margin-top: 0in;" type="circle">
<li class="MsoNormal"><b>Sodium-potassium
pump maintains resting potential</b></li>
<li class="MsoNormal"><b>Graded
potentials alter the resting potential</b></li>
<li class="MsoNormal"><b>An
action potential is a sudden reversal of membrane voltage</b></li>
<li class="MsoNormal"><b>Action
potentials are all-or-none and self-propagating</b></li>
</ul>
</ul>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Neuroglial Cells Support
and Protect Neurons</b></span></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Information is Transferred
from a Neuron to its Target</b></span></div>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc"><ul style="margin-top: 0in;" type="circle">
<li class="MsoNormal"><b>Neurotransmitter
is released</b></li>
<li class="MsoNormal"><b>Neurotransmitters
exert excitatory or inhibitory effects</b></li>
<li class="MsoNormal"><b>Postsynaptic
neurons integrate and process information</b></li>
</ul>
</ul>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 16pt;"><b>Sensory Mechanisms</b></span></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Receptors Receive and
Convert Stimuli</b></span></div>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc"><ul style="margin-top: 0in;" type="circle">
<li class="MsoNormal"><b>Receptors
are classified according to stimulus</b></li>
<li class="MsoNormal"><b>The
CNS interprets nerve impulses based on origin and frequency</b></li>
<li class="MsoNormal"><b>Some
receptors adapt to continuing stimuli</b></li>
<li class="MsoNormal"><b>Somatic
sensations and special senses provide sensory information</b></li>
</ul>
</ul>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Somatic Sensations Arise
from Receptors Throughout the Body</b></span></div>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc"><ul style="margin-top: 0in;" type="circle">
<li class="MsoNormal"><b>Mechanoreceptors
detect touch, pressure, and vibration</b></li>
<li class="MsoNormal"><b>Mechanoreceptors
indicate limb position, muscle length, and tension</b></li>
<li class="MsoNormal"><b>Thermoreceptors
detect temperature</b></li>
<li class="MsoNormal"><b>Pain
receptors signal discomfort</b></li>
</ul>
</ul>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Vision: Detecting and
Interpreting Visual Stimuli</b></span></div>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc"><ul style="margin-top: 0in;" type="circle">
<li class="MsoNormal"><b>Structure
of the eye</b></li>
<li class="MsoNormal"><b>Regulating
the amount of light and focusing the image</b></li>
<li class="MsoNormal"><b>Eyeball
shape affects focus</b></li>
<li class="MsoNormal"><b>Light
is converted into action potentials</b></li>
<li class="MsoNormal"><b>Rods
and cones respond to light</b></li>
<li class="MsoNormal"><b>Rods
provide vision in dim light</b></li>
<li class="MsoNormal"><b>Cones
provide color vision and accurate images</b></li>
<li class="MsoNormal"><b>Visual
receptors adapt</b></li>
</ul>
</ul>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Disorders of Sensory Mechanisms</b></span></div>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc"><ul style="margin-top: 0in;" type="circle">
<li class="MsoNormal"><b>Disorders
of the ears</b></li>
<li class="MsoNormal"><b>Disorders
of the eyes</b></li>
</ul>
</ul>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b></b></div>
<div class="MsoNormal">
<span style="font-size: 16pt;"><b>Human Impacts,
Biodiversity, and Environmental Issues</b></span></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Pollutants Impair Air
Quality</b></span></div>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc"><ul style="margin-top: 0in;" type="circle">
<li class="MsoNormal"><b>Excessive
greenhouse gases lead to global warming</b></li>
<li class="MsoNormal"><b>CFCs
deplete the ozone layer</b></li>
<li class="MsoNormal"><b>Pollutants
produce acid precipitation</b></li>
<li class="MsoNormal"><b>Smog
blankets industrial areas</b></li>
</ul>
</ul>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Pollution Jeopardizes
Scarce Water Supplies</b></span></div>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc"><ul style="margin-top: 0in;" type="circle">
<li class="MsoNormal"><b>Water
is scarce and unequally distributed</b></li>
<li class="MsoNormal"><b>Urbanization
increases storm water runoff</b></li>
<li class="MsoNormal"><b>Human
activities pollute freshwater</b></li>
<li class="MsoNormal"><b>Groundwater
pollution may impair human health</b></li>
<li class="MsoNormal"><b>Oil
pollution damages oceans and shorelines</b></li>
</ul>
</ul>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Pollution and Overuse
Damage the Land</b></span></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal" style="margin-left: 1in; text-indent: -0.25in;">
<span style="font-family: Symbol;">·<span style="font: 7pt "Times New Roman";"> </span></span><b>Summary</b></div>
<div class="MsoNormal" style="margin-left: 1in; text-indent: -0.25in;">
<br /></div>
<div class="MsoNormal" style="margin-left: 1in; text-indent: -0.25in;">
<br /></div>
<div class="MsoNormal" style="margin-left: 1in; text-indent: -0.25in;">
<br /></div>
<div class="MsoNormal" style="margin-left: 1in; text-indent: -0.25in;">
<style>
@font-face {
font-family: "Times New Roman";
}@font-face {
font-family: "Courier New";
}@font-face {
font-family: "Wingdings";
}p.MsoNormal, li.MsoNormal, div.MsoNormal { margin: 0in 0in 0.0001pt; font-size: 12pt; font-family: "Times New Roman"; }table.MsoNormalTable { font-size: 10pt; font-family: "Times New Roman"; }div.Section1 { page: Section1; }ol { margin-bottom: 0in; }ul { margin-bottom: 0in; }
</style>
</div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhLNvKsuIPFJqvBgzP16mQr3tLbmhb9Ha4yJQfO3ASNuRzLh37Ff3b9Zzug1waPF6ABubxXjZ6hp0YCbnUjqYVuyrP1pgOGLYDIbRlq3Y0hv6nqOShOLguz05dUMQFYT8zF1iRXOcjZ3rh9/s1600/digest1" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="200" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhLNvKsuIPFJqvBgzP16mQr3tLbmhb9Ha4yJQfO3ASNuRzLh37Ff3b9Zzug1waPF6ABubxXjZ6hp0YCbnUjqYVuyrP1pgOGLYDIbRlq3Y0hv6nqOShOLguz05dUMQFYT8zF1iRXOcjZ3rh9/s200/digest1" width="166" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">resources.teachnet.ie/accessed 5/7/12</td></tr>
</tbody></table>
<div class="MsoNormal">
<span style="font-size: 16pt;"><b>The Digestive System and
Nutrition</b></span></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>The Digestive System
Brings Nutrients into the Body</b></span></div>
<div class="MsoNormal">
The digestive system is made of a series of hollow organs
that extend from the mouth to the anus: the mouth, pharynx, esophagus, stomach
small intestine, large intestine, rectum, and anus. They form a hollow tube
that we call the gastrointestinal tract. The space within this tube is the
lumen. This system also carries four accessory organs – the salivary glands,
liver, gallbladder, and pancreas. Each one of these organs share the function
of getting nutrients into the body.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>The walls of the GI tract are composed of four layers</b></div>
<div class="MsoNormal">
There are four layers that form the walls of the GI tract
from the esophagus to the anus:</div>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal">The
mucosa – innermost tissue made of mucous membrane (all nutrients must
cross this to enter the bloodstream).</li>
</ul>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal">The
submucosa – next to the mucosa layer and made of connective tissue, which
contain blood vessels, lymph vessels, and nerves. </li>
</ul>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal">The
muscularis – the third layer, which consists of two to three layers of
smooth tissue is responsible for motility (movement).</li>
</ul>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal">The
serosa – the outermost layer consisting of a thin connective tissue
sheath. It surrounds and protects the other layers and attaches the
digestive system to the body cavity walls.</li>
</ul>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
The organs of the digestive tract are separated by
sphincters, or thick rings of smooth muscle. When these contract, they close
off the passageway between organs.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Five basic processes accomplish digestive system function</b><br />
<b><a href="http://www.youtube.com/watch?feature=endscreen&v=qyJx_UVEgQI&NR=1" target="_blank">Click Here to View A Digestive Process Video</a> </b><br />
<b></b><br />
<b></b><br />
<b></b><br />
<b><span id="goog_1934165090"></span><span id="goog_1934165091"></span></b></div>
<div class="MsoNormal">
The process of taking food apart so that the nutrients in
the food can be absorbed into the body is done by these five basic tasks:</div>
<div class="MsoNormal">
<br /></div>
<ol start="1" style="margin-top: 0in;" type="1">
<li class="MsoNormal">Mechanical
processing and movement -
(This is obviously chewing, which breaks food into smaller pieces
and propels it forward.)</li>
<li class="MsoNormal">Secretion
– Along the digestive tract at various places, fluid, digestive enzymes,
acid, alkali, bile and mucus are all secreted. We also have a few hormones
that are secreted into the blood that regulate digestion.</li>
<li class="MsoNormal">Digestion
– the contents in the lumen break down into smaller and smaller particles
until you have nutrient molecules.</li>
<li class="MsoNormal">Absorption
– nutrients pass over from the mucosal layer and into the blood or lymph.</li>
<li class="MsoNormal">Elimination
– anything that is not digested is eliminated via the anus. </li>
</ol>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Two types of motility aid digestive processes</b></div>
<div class="MsoNormal">
There are two types of motion within the GI tract and they
function very differently. Peristalsis propels food forward. It starts when a
lump of food (bolus) stretches part of the GI tract, which causes the smooth
muscle in front to relax and the muscle behind to contract. This motion pushes
the food forward.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
Segmentation, on the other hand, mixes the food. There are
sections of smooth muscle that randomly contract and relax, mixing up the
contents. This eventually causes absorption and primarily takes place in the
small intestine.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjF1oDZSHPg4qAqqUK5JlwWADIEAuTdnPrl0EvfKjpVekld8BovpsZiYYU_9a1RahRl3Z0eNuBnh87dUum_mE-IJPbjhdA4gQCRWZ-V-1tn9Djpx1EkxsntlI4o2jGP5RBuamLQfILJCl1m/s1600/teethtypes" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjF1oDZSHPg4qAqqUK5JlwWADIEAuTdnPrl0EvfKjpVekld8BovpsZiYYU_9a1RahRl3Z0eNuBnh87dUum_mE-IJPbjhdA4gQCRWZ-V-1tn9Djpx1EkxsntlI4o2jGP5RBuamLQfILJCl1m/s1600/teethtypes" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">seattlechildrens.org/accessed 5/7/12</td></tr>
</tbody></table>
<span style="font-size: 14pt;"><b>The Mouth Processes Food
for Swallowing</b></span></div>
<div class="MsoNormal">
<b>Teeth bite and chew food</b></div>
<div class="MsoNormal">
Our mouth basically functions as a food processor. This is
where it all starts. We have four types of teeth and each has a special
function. Incisors cut the food, canines tear it, premolars and molars grind
and crush. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>The tongue positions and tastes food</b></div>
<div class="MsoNormal">
The tongue is skeletal muscle and is enclosed by mucous
membrane. It makes chewing more efficient, positioning the food over the teeth
and mashing it against the roof of the mouth. It also contributes to our sense
of taste and speech.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Saliva begins the process of digestion</b></div>
<div class="MsoNormal">
Our saliva glands produce saliva, making it easier to chew
and swallow. Saliva contains four main ingredients: mucin (protein) – holds the
food together so we can swallow easier, salivary amylase (enzyme) – begins
digesting carbohydrates, bicarbonate (HCO3) – maintains pH, and lysozyme
(enzyme) – inhibits bacterial growth. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>The Pharynx and Esophagus
Deliver Food to the Stomach</b></span></div>
<div class="MsoNormal">
Our tongue pushes food into the pharynx for swallowing,
which causes a temporary halt in our breathing. It starts with a voluntary
movement, but once in the pharynx, becomes an involuntary movement - the
swallowing reflex. The esophagus is just beyond the pharynx, and connects to
the stomach. The lining in the esophagus secretes a mucus that helps slide the
food down. Once it hits the bottom of the esophagus, the sphincter opens very
briefly and passes the contents into the stomach. It also prevents back-flow
from the stomach. (It is the
malfunction of the sphincter that causes acid reflux). </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>The Stomach Stores Food,
Digests Protein, and Regulates Delivery</b></span></div>
<div class="MsoNormal">
The stomach is a muscular sac that expands and has three
functions. It stores food, digests food and regulates delivery.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Gastric juice breaks down proteins</b></div>
<div class="MsoNormal">
Gastric juice is a combination of hydrochloric acid, pepsinogen,
which becomes pepsin (a protein digesting enzyme) once exposed to stomach acid,
and other fluids. It has an acidic pH of 2, allowing the dissolving of
connective tissue in food and the digestion of proteins and peptides into amino
acids. This is then delivered into the small intestine and at this point is
called chyme. The pyloric sphincter between the stomach and small intestine
regulates the rate of transport. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgT3T5wtiRftxR-ZYWwxU81qcbnM6Obzg0K_rrl30GxaRWTW756yNOin09oWlKycgHqdYWAlTtzRZlp8UAbz9Ic5SkxAubAncSHKYuFsNEUNJs9m7O6vdr9asM0ztMIBcpPJK46VUpze1r0/s1600/stomach" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="225" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgT3T5wtiRftxR-ZYWwxU81qcbnM6Obzg0K_rrl30GxaRWTW756yNOin09oWlKycgHqdYWAlTtzRZlp8UAbz9Ic5SkxAubAncSHKYuFsNEUNJs9m7O6vdr9asM0ztMIBcpPJK46VUpze1r0/s320/stomach" width="320" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">accessed 5/7/12</td></tr>
</tbody></table>
<b>Stomach contractions mix food and push it forward</b></div>
<div class="MsoNormal">
After a meal, your stomach contractions stop and the stomach
stretches to accommodate the food. This signals peristalsis to increase, which
causes a mixing motion. With each contraction, approximately a tablespoon of
chyme enters the small intestine. When you hear your stomach gurgling, that is
peristalsis. It takes two – six hours for your stomach to empty completely. And
when there is high fat or acid content in your stomach, the chyme triggers the
release of hormones that slow down peristalsis so the small intestine have more
time to absorb the nutrients.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>The Small Intestine
Digests Food and Absorbs Nutrients and Water</b></span></div>
<div class="MsoNormal">
The two major functions of the small intestine are digestion
and absorption. Protein digestion continues and carbohydrate and lipid
digestion is added to the mix. This is where the acidic gastric juice begins to
neutralize, when the pancreas and intestines add enzymes. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj6AVPjf_Zlz41o0Ear-VzzcwCIdFnTO0Jt_Qfq687eHGGsCoYzbs0fMZQA-7hRYS_mQQ37cwi0CF9uBvI7XhuZVGP434D8XEoMxvj6-6S6YT0ut7b6TFGsYOqfXfzTJRcrEVMW6EYxsKQs/s1600/smallintestines" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="208" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj6AVPjf_Zlz41o0Ear-VzzcwCIdFnTO0Jt_Qfq687eHGGsCoYzbs0fMZQA-7hRYS_mQQ37cwi0CF9uBvI7XhuZVGP434D8XEoMxvj6-6S6YT0ut7b6TFGsYOqfXfzTJRcrEVMW6EYxsKQs/s320/smallintestines" width="320" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">uvahealth.com/accessed 5/7/12</td></tr>
</tbody></table>
During absorption, all is broken down to a single amino
acid, monosaccharide, fatty acid, or glycerol. These are now small enough to transport across the mucosal
cells and into the blood. Almost 90% of nutrients and water are absorbed here.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
There are three regions of the small intestine. The duodenum
is the first section. Almost 10 inches long, this is where most of the
digestion occurs. Then the product of digestion is absorbed in the other two
sections – the jejunum and ileum, which are approximately 10 feet long,
combined. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
It is the structure of the small intestine that make it
suited for absorption. There are large folds covered in villi (microscopic projections),
and these have even smaller projections, or microvilli. Between the folds,
villi, and microvilli, the surface area of the small intestine can increase up
to 500 times. This increases its ability to absorb. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Accessory Organs Aid
Digestion and Absorption</b></span></div>
<div class="MsoNormal">
Since we have already covered the salivary glands, now we
need to look at the other three organs that play a role in digestion and
absorption.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>The pancreas secretes enzymes and NaHCO3</b></div>
<div class="MsoNormal">
The pancreas has both endocrine and exocrine functions. It
secretes hormones that regulate blood glucose. But it also secretes digestive
enzymes and sodium bicarbonate. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgl_yWG-E_BKkw1aWRNfbIGBwj65hrBehADyE9PMvszD_Xl5vERY2JEhQabhuGHsP7vlWdrCeIbEFN_-lryz5Y6H-l3iVsoi2YlxUiFfSIBsW0pNdmbyJdzqmXRCLa-6QAQzGyMIQ-9BPFu/s1600/liver+and+pancreas+" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="304" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgl_yWG-E_BKkw1aWRNfbIGBwj65hrBehADyE9PMvszD_Xl5vERY2JEhQabhuGHsP7vlWdrCeIbEFN_-lryz5Y6H-l3iVsoi2YlxUiFfSIBsW0pNdmbyJdzqmXRCLa-6QAQzGyMIQ-9BPFu/s320/liver+and+pancreas+" width="320" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">arthursclipart.org/accessed 5/7/12</td></tr>
</tbody></table>
The enzymes include proteases (trypsin, chymotrypsin, and
carboxypeptidase), which digest proteins; pancreatic amylase, which continues
digestion of carbohydrates; and lipase, which digests lipids.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
Sodium bicarbonate works to neutralize stomach acid.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>The liver produces bile and performs many other functions</b></div>
<div class="MsoNormal">
The liver is located in the upper right abdominal cavity and
has many functions. It’s primary digestive function is producing bile, Bile is
a watery mixture of electrolytes, cholesterol, bile salts, lecithin, and
pigments (mostly bilirubin). </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
One of the most important GI tract features is the hepatic
portal system. This system carries blood from one capillary bed to another. It
takes nutrient-rich blood directly from the digestive organs to the liver via
the hepatic portal vein. The blood is then returned to general circulation. The
location of the liver is ideal for processing and storing nutrients.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
The following is a list of the other functions of the liver.</div>
<div class="MsoNormal">
<a href="http://www.youtube.com/watch?v=tat0QYxlCbo&feature=related" target="_blank">Click Here to View How the Liver Works</a><br />
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal">Stores
fat-soluble vitamins (A,D,E, and K) and iron.</li>
<li class="MsoNormal">Stores
glucose as glycogen after a meal, and converts glycogen to glucose between
meals.</li>
<li class="MsoNormal">Manufacturing
plasma proteins like albumin and fibrinogen from amino acids.</li>
<li class="MsoNormal">Synthesizing
and storing lipids.</li>
<li class="MsoNormal">Inactivating
many chemicals, including alcohol, hormones, drugs, and poisons.</li>
<li class="MsoNormal">Converting
ammonia (a toxic waste of metabolism) into urea.</li>
<li class="MsoNormal">Destroying
worn-out red blood cells.</li>
</ul>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjTU4ET3HIosdlDEI8Gv3oUtcFh2dtz2SZaZnm_88oq5WUHULO2wl4LCIVA_kh1sjoHn-WKmvInTra8S6s09RigdoxYO9AVEbLV7WwuJAcK5vmqWcctTv7tb_zubPN-FXheYFr8sm8NRaNb/s1600/gallbladder+" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="158" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjTU4ET3HIosdlDEI8Gv3oUtcFh2dtz2SZaZnm_88oq5WUHULO2wl4LCIVA_kh1sjoHn-WKmvInTra8S6s09RigdoxYO9AVEbLV7WwuJAcK5vmqWcctTv7tb_zubPN-FXheYFr8sm8NRaNb/s200/gallbladder+" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">healthinessbox.wordpress.com/accessed 5/7/12</td></tr>
</tbody></table>
<b>The gallbladder stores bile until needed</b></div>
<div class="MsoNormal">
Bile leaves the liver via ducts to the gallbladder, where
water is removed. The concentrated bile is stored here until after a meal, when
it is released into the small intestine through the bile duct, which joins the
pancreatic duct.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<br />
<br />
<span style="font-size: 14pt;"><b>The Large Intestine
Absorbs Nutrients and Eliminates Wastes</b></span></div>
<div class="MsoNormal">
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgt0k0_A8cTIc_JF03pRa7RjmeE53hUapKkf2UvJzV7VzVEATipGl-6l6TcGUSpGiFnef23PZN5GHfQKOLJix3NJ7c2ZFge57KVuniKTrLeMWCcSbm3ZJYKMRG9HKkzqWY6DV_9ggSTMcja/s1600/largeintestines" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="150" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgt0k0_A8cTIc_JF03pRa7RjmeE53hUapKkf2UvJzV7VzVEATipGl-6l6TcGUSpGiFnef23PZN5GHfQKOLJix3NJ7c2ZFge57KVuniKTrLeMWCcSbm3ZJYKMRG9HKkzqWY6DV_9ggSTMcja/s200/largeintestines" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">metabolicmeanderings.tumbir.com/accessed 5/7/12</td></tr>
</tbody></table>
Most of the water and nutrients have been absorbed by the
time it reaches the large intestine. Whatever does remain is absorbed by the
large intestine and now you have nearly solid waste. This intestine is larger
in diameter, but only half as long as the small intestine. It begins with a
pouch, called the cecum, where chyme is received from the small intestine.
There is a small fingerlike pouch extending from the cecum, the appendix, which
has no known digestive function. There are four regions of the large intestine,
or colon – the ascending colon on the right side of the body, the transverse
colon that crosses over to the left, the descending colon passing down the left
side, and the end, or sigmoid colon. The sigmoid colon stores feces until
defecation when they pass through the rectum to the anus. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>How Nutrients are Absorbed</b></span><br />
<span style="font-size: 14pt;"><b><a href="http://nutrition.jbpub.com/resources/animations.cfm#" target="_blank">Click Here to View numerous clips on digestion</a> </b></span></div>
<div class="MsoNormal">
How absorption occurs depends on the type of nutrient.</div>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal"><b>Proteins
and carbohydrates are absorbed by active transport</b><span style="font-weight: normal;"> – once enzymes have broken down proteins into
amino acids, they are actively transported into mucosal cells. Then they
move via diffusion into the capillaries. What remains of carbohydrates
become monosaccharides, which are transported the same way only by
different active transport proteins.</span></li>
<li class="MsoNormal"><b>Lipids
are broken down, then reassembled</b><span style="font-weight: normal;"> –
fatty acids and monoglycerides are the products of lipid digestion. They
dissolve quickly in micelles (small droplets made of bile salts and
lecithin). The micelles transport to the outer surface of the mucosal
cells, where they are absorbed. Once the fatty acids and monoglycerides
are in, they recombine and become triglycerides.</span></li>
<li class="MsoNormal"><b>Water
is absorbed by osmosis</b><span style="font-weight: normal;"> – when
nutrients are absorbed in the small intestine or when you drink large
amounts of water, the concentration of water in the lumen becomes higher
than in the intestinal cells or in the blood. This causes the diffusion of
water through the epithelial layer of cells of the small intestine and
into the blood. The capacity of water absorption by the small intestine is
almost limitless.</span></li>
<li class="MsoNormal"><b>Vitamins
and minerals follow a variety of paths</b><span style="font-weight: normal;">
– Fat soluble vitamins are dissolved in micelles and absorbed by diffusion
across the lipid membrane. Water-soluble vitamins are absorbed by active
transport or diffusion through channels or pores. Minerals are also
absorbed via active transport or diffusion also, via transport proteins,
pores, or channels.</span></li>
</ul>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Endocrine and Nervous
Systems Regulate Digestion</b></span></div>
<div class="MsoNormal">
Whereas most regulatory mechanisms are operating to maintain
a constant internal environment or homeostasis, the regulation of the digestive
system actually promotes rapid, efficient digestion and absorption, regardless
of homeostasis. The digestive process actually alters the internal environment
for a short time because absorption of nutrients entering the blood takes only
a few hours. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Regulation depends on volume and content of food</b></div>
<div class="MsoNormal">
Stretching of the stomach and proteins stimulate the stomach
to release the hormone, gastrin, which triggers more gastric juice. Then when
chyme arrives at the small intestine, the stretching of the duodenum increases
segmentation to mix the chyme. The duodenum also secretes secretin and
cholecystokinin (CCK) hormones. Acid triggers secretin and fat and protein
trigger CCK.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Nutrients are used or stored until needed</b></div>
<div class="MsoNormal">
Regulation of organic metabolism involves almost every organ
in the body working together. Although the main two key players are the
pancreas and the liver. What the body does with molecules, whether actively
using them or storing them, depends on what is in short supply or excess at any
given moment. When we consume more energy containing nutrients than what we
use, our bodies store them for the future. This can cause weight gain over
time. When we consume fewer energy-containing nutrients, our bodies draw on the
stored nutrients. This can cause loss of weight over time.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Nutrition: You Are What
You Eat</b></span></div>
<div class="MsoNormal">
Because most nutrients enter the body via the digestive
system, the phrase “you are what you eat” is very accurate.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhlAQ7rx1T_iaAuq7lU6EWk9alAcno-BUonCJ1sczJG_vZhwppGlcG6om-Fgch13rWs9XfCniSve1wsnzED3HSKVcBjuX4WBmIN_cDlyi0l9edRza3xN9RKBO7eMpob6Mk0MBtABHBo0G5u/s1600/nutritionpyramid" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="320" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhlAQ7rx1T_iaAuq7lU6EWk9alAcno-BUonCJ1sczJG_vZhwppGlcG6om-Fgch13rWs9XfCniSve1wsnzED3HSKVcBjuX4WBmIN_cDlyi0l9edRza3xN9RKBO7eMpob6Mk0MBtABHBo0G5u/s320/nutritionpyramid" width="247" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">neatsolutions.com/accessed 5/7/12</td></tr>
</tbody></table>
<b>MyPyramid plan offers a personalized approach</b></div>
<div class="MsoNormal">
The My Pyramid plan is a website developed by the Center for
Nutrition Policy and Promotions at the USDA. It is a fairly comprehensive,
personalized approach that includes physical activity as well as nutrition. You
can enter your age, gender, and activity level on the website, and this system
will match you to the best plan for your needs. It is a good place to start for
basic information on a healthy diet. In general, that will include: eating a
variety of foods, maintaining a healthy weight, eating plenty of fresh fruits,
vegetables, and whole-grains, keeping cholesterol and saturated fats at a
minimum, using sugar, salt, and sodium in moderation, and drinking alcohol in
moderation.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Carbohydrates: A major energy source – </b><span style="font-weight: normal;">Many nutritionists recommend 45-65% of calorie
intake come from carbohydrates. It is the body’s main source of energy. There
are two types of carbs – simple and complex. Complex carbs are the more
desirable because they release sugars more slowly and contribute fiber,
vitamins, and minerals. Simple
carbs are sugars found in natural foods such as fruit and honey. Refined
sugars, such as corn syrup and granulated sugar, have had most of their
nutrients removed, and are far less nutritious. The commercials for “corn”
sugar, are at best, misleading. “Sugar” is not “sugar”, as they claim.</span></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Lipids: Essential cell components and energy sources – </b><span style="font-weight: normal;">Lipids, including fats, are components of every
living cell. Fat stores energy, cushions organs, insulates the body under the
skin, and stores several vitamins. But most of us consume far more than what we
need. They should account for no more than 20-35% of calories in our diet per
day. Diets high in saturated fat, cholesterol, and trans fats place us at
higher risk for cardiovascular disease and cancer.</span></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Complete proteins contain every amino acid – </b><span style="font-weight: normal;">Proteins are vital to every cell, just like lipids
are. They form enzymes that direct metabolism, serve as receptor and transport
molecules, build muscle fibers, and a few are hormones. Proteins are composed
of 20 amino acids. Our bodies produce 12 of these. The other 8 (essential amino
acids) must be ingested in food. A complete protein contains all 20. (Please
see the chart). Approximately 15% of our calories should come from protein. It
is critical during pregnancy and childhood that the amino acids are balanced.
Any one amino acid missing from the diet can retard growth and alter mental and
physical performance.</span></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Vitamins are essential for normal function – </b><span style="font-weight: normal;">There are at least 13 chemicals, or vitamins that
are needed for proper function. Our bodies only produce a couple of these:
vitamin D (skin synthesis when exposed to sunlight), and bacteria in the colon
that produce vitamins K, B6, and biotin. All other vitamins must come from
food. They fall into two categories: fat and water soluble. The difference is
how they are absorbed. Fat soluble vitamins are absorbed along with fat and
excess is stored for later use. Water soluble vitamins are absorbed more
readily, but are only stored very briefly and then excreted in urine. So, we
need to consume these on a regular basis.</span><br />
</div>
<div class="MsoNormal">
<a href="http://www.holistichelp.net/minerals.html" target="_blank">Click Here to vew an article on the connection of minerals and disease</a></div>
<div class="MsoNormal">
<b>Minerals: Elements essential for body processes – </b><span style="font-weight: normal;">Minerals are the atoms of chemical elements and
essential for body function also. They are the ions in blood plasma and cell
cytoplasm, they are the chemical structure of bones, and they contribute to
nerve and muscle activity. There are 21 minerals considered essential for
animals. Nine of these are trace minerals – they make up less than 0.01% of
your body weight. </span></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Fiber benefits the colon – </b><span style="font-weight: normal;">Doctors recommend eating 20-35 grams of fiber each day, which is more
than what most of us get. Fiber is found in a variety of vegetables, fruit, and
grains. It is an indigestible material, but is beneficial to our bodies. When
you have a low-fiber diet, it causes chronic constipation, hemorrhoids, and
diverticulosis. It is also associated with higher risk of developing colon
cancer. Eat your fiber!</span></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Weight Control: Energy
Consumed Versus Energy Spent</b></span></div>
<div class="MsoNormal">
Energy is measured via calories. Scientists use 1000
kilocalories to measure nutrient content. Calorie with a capital “C” is what
denotes this. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>BMR: Determining how many Calories we need</b></div>
<div class="MsoNormal">
To maintain a stable body weight, the number of Calories
must equal the number we use. Your basal metabolic rate (BMR) I what determines
your caloric energy needs. This is the energy your body needs to breathe,
maintain organ function, etc… BMR can be influenced by the following:</div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal">Gender
and body composition</li>
<li class="MsoNormal">Age</li>
<li class="MsoNormal">Health</li>
<li class="MsoNormal">Stress</li>
<li class="MsoNormal">Food
intake</li>
<li class="MsoNormal">Genetics</li>
</ul>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Energy balance and body weight</b></div>
<div class="MsoNormal">
A healthy weight is a balancing act between energy intake
and energy expenditure. Our excess is stored in fat cells. Studies have found
that overweight people have two to three times more fat cells than a normal
individual. So when they diet, they shrink their fat reserves in each cell,
which is why their bodies respond as if they are starving. Dieting is difficult
for chronically overweight people because they are fighting the body’s own
weight-control system.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgW8Xc59Z12RNO55WYdRoGIbZtic9-lN-qbRGxtncxQXdTRSQPLzJCSMn_Cjy96K1FPp5DiU1kL8scVI0pFe4xdkHPsTMY0BUBjz03PLMUKHvztOkbtwzM8Ela1cVADE8W9bVe_wFsBLzHj/s1600/skating" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="160" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgW8Xc59Z12RNO55WYdRoGIbZtic9-lN-qbRGxtncxQXdTRSQPLzJCSMn_Cjy96K1FPp5DiU1kL8scVI0pFe4xdkHPsTMY0BUBjz03PLMUKHvztOkbtwzM8Ela1cVADE8W9bVe_wFsBLzHj/s200/skating" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">inlineskating.about.com/accessed 5/7/12</td></tr>
</tbody></table>
<b>Physical activity: An efficient way to use Calories</b></div>
<div class="MsoNormal">
Even though our BMR stays fairly constant, we can have a
drastic effect on the amount of Calories we burn via exercise. To lose one
pound of fat, we must use up about 3500 Calories. The best approach is a
gradual one, decreasing caloric intake in small amounts while increasing
physical activity gradually. Not only will exercise affect weight, it improves
your cardiovascular system, strengthens bones, tones muscle, and promotes a
general sense of well-being.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Healthy weight improves overall health</b></div>
<div class="MsoNormal">
The reason we worry about our weight is a direct correlation
between obesity and health status. But the real reason is because $80 billion
is spent annually on nutrition related health problems. So the government is
concerned. Both the government and insurance companies regularly publish body
mass index (BMI) charts, using a persons height and weight. But these numbers
are a guideline only. There are other factors it does not account for. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Disorders of the Digestive
System</b></span></div>
<div class="MsoNormal">
There are many common digestive problems which are not necessarily
life threatening. One of the most common is food poisoning, caused by
contaminated food or beverage with bacteria or their toxic products. Food
allergies is another common problem.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Disorders of the GI tract</b></div>
<div class="MsoNormal">
The following is a list of fairly common disorders of the GI
tract.</div>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal">Lactose
intolerance: difficulty digesting milk</li>
<li class="MsoNormal">Peptic
ulcers: sores in the stomach</li>
<li class="MsoNormal">Celiac
disease: gluten intolerance</li>
<li class="MsoNormal">Diverticulosis:
weakness in the wall of the large intestine</li>
<li class="MsoNormal">Colon
polyps: noncancerous growths</li>
</ul>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Disorders of the accessory organs</b></div>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal">Hepatitis:
inflammation of the liver </li>
<li class="MsoNormal">Gallstones:
can obstruct bile flow</li>
</ul>
<br />
<ul style="margin-top: 0in;" type="disc">
</ul>
<div class="MsoNormal">
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEixU4IwoHJQCPhjv978v7dG9rDcPgJKLuaX9nTU3Szpi58NFYgHc1EDWzuxp3N5-J2kRVW67oOHNJn8lS4TxNMjnXs2JBXRPs9XMAmWxstXV8Mm1VE8IwJ7bLvCWbZ0VvyaPXXmWzAZKyw1/s1600/malnutrition" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="211" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEixU4IwoHJQCPhjv978v7dG9rDcPgJKLuaX9nTU3Szpi58NFYgHc1EDWzuxp3N5-J2kRVW67oOHNJn8lS4TxNMjnXs2JBXRPs9XMAmWxstXV8Mm1VE8IwJ7bLvCWbZ0VvyaPXXmWzAZKyw1/s320/malnutrition" width="320" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">arabiangazette.com/accessed 5/7/12</td></tr>
</tbody></table>
<b>Malnutrition: Too many or too few nutrients</b></div>
<div class="MsoNormal">
Malnutrition refers to conditions where human development
and function are compromised by an unbalanced diet. It can be caused by either
overnutrition or undernutrition. Overnutrition can lead to obesity, but the far
greater problem is undernourishment. It is estimated that 800 million people
worldwide are undernourished. Nearly 20 million people, most children, die every
year of starvation or related diseases.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Obesity: A worldwide epidemic?</b></div>
<div class="MsoNormal">
The rise in obesity, just in the U.S. has risen from 12.6%
in 1990 to 34% in 2006. The collective gene pool cannot change that quickly. So
we must look at environmental factors to account for this. Computers, cars,
television, and desk jobs have all combined to produce a more sedentary
lifestyle. Food has also become relatively cheap and readily available. So we
evidently eat and drink more. Additional fats and oils in our diet, account for
42% of this increase. It seems to me it is time to take a look at the food
industry and what they are selling to the public. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgijPs1Bf07Bct8VH9k5Efah3aHgA_HFFyAdQdvG_jZcFDWbpawU6UgdOX17Oy-TQTXfE6ZFaGo_ojjY27oo3CV1iyrrqArjLVNhqxaMkHXl5rLNT6jikjAj_vWetd1sr9xxa_T6n4jhQuz/s1600/anorexia" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="320" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgijPs1Bf07Bct8VH9k5Efah3aHgA_HFFyAdQdvG_jZcFDWbpawU6UgdOX17Oy-TQTXfE6ZFaGo_ojjY27oo3CV1iyrrqArjLVNhqxaMkHXl5rLNT6jikjAj_vWetd1sr9xxa_T6n4jhQuz/s320/anorexia" width="219" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">students.cis.uab.edu/accessed 5/7/12</td></tr>
</tbody></table>
<br />
<span style="font-size: 14pt;"><b>Eating Disorders: Anorexia
Nervosa and Bulimia</b></span></div>
<div class="MsoNormal">
Eating disorders are not truly digestive disorders, but
involve the nervous system. With anorexia, a person diets excessively until
they stop eating altogether. With bulimia, people binge and purge in a vicious
cycle. These eating disorders seem to have deep roots in psychological and
cultural factors. Both play havoc with the body and mind. It usually requires a
team of professionals to treat these disorders, from medical, dental, and
psychiatric, to nutritional needs.<br />
<br />
</div>
<b></b><br />
<style>
@font-face {
font-family: "Times New Roman";
}@font-face {
font-family: "Courier New";
}@font-face {
font-family: "Wingdings";
}p.MsoNormal, li.MsoNormal, div.MsoNormal { margin: 0in 0in 0.0001pt; font-size: 12pt; font-family: "Times New Roman"; }table.MsoNormalTable { font-size: 10pt; font-family: "Times New Roman"; }div.Section1 { page: Section1; }ol { margin-bottom: 0in; }ul { margin-bottom: 0in; }
</style>
<br />
<div class="MsoNormal">
<br /></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgT7vz4v6E3k-TDo3p0yuGG8AkK39K-wBg-c58PBfH0CkHBY8ITHyXTzT0F9W80z5vbgaCuMAybO6WQmxkvlhvrJr1Nw6LC1Xw5z0lD_Rhh_3sd6PKy1NfSHCrnJjGu8F-p9T9cibzaKqjf/s1600/brainnueron+" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="240" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgT7vz4v6E3k-TDo3p0yuGG8AkK39K-wBg-c58PBfH0CkHBY8ITHyXTzT0F9W80z5vbgaCuMAybO6WQmxkvlhvrJr1Nw6LC1Xw5z0lD_Rhh_3sd6PKy1NfSHCrnJjGu8F-p9T9cibzaKqjf/s320/brainnueron+" width="320" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">scientopia.org/accessed 5/7/12</td></tr>
</tbody></table>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 16pt;"><b>The Nervous System:
Integration and Control</b></span></div>
<div class="MsoNormal">
Our nervous systems have four characteristics:</div>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal">It
receives information from many different senses simultaneously.</li>
<li class="MsoNormal">It
integrates information – taking different pieces of information from many
different sources and assembling it into something that makes sense.</li>
<li class="MsoNormal">It is
very fast – receiving and integrating information and producing a response
within tenths of a second.</li>
<li class="MsoNormal">It can
initiate specific responses, including muscle contractions, glandular
secretion, and conscious thought and emotions. </li>
</ul>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>The Nervous System has Two
Principal Parts</b></span></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b><a href="http://www.dnatube.com/video/2116/Nervous-System-how-it-works" target="_blank">Click Here to view how the Nervous system works</a> </b></span></div>
<div class="MsoNormal">
The nervous system is divided into two parts: the central
nervous system (CNS) and the peripheral nervous system (PNS). The CNS consists
of the brain and spinal cord. It functions to receive, process, store, and
transfer information. The PNS includes everything else that lies outside of the
CNS. The PNS has two distinct subdivisions: the sensory division, which carries
information from the brain and spinal cord; and the motor division, which
carries information from the CNS to all other parts of the body. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
The PNS if further divided according to function. There is
the somatic division, which controls skeletal muscles; and the autonomic
division, which controls smooth muscle, cardiac muscle, and glands. Then within
the autonomic division, you have the sympathetic and parasympathetic divisions.
These two divisions oppose one another for the most part, in order to
accomplish automatic, subconscious maintenance of homeostasis. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Neurons are the
Communication Cells of the Nervous System</b></span></div>
<div class="MsoNormal">
Neurons are highly specialized for communication. They
generate and conduct electrical impulses (action potentials), from one part of
the body to another. They consist of a cell body, one or more dendrites, and an
axon. There are three types of neurons:</div>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal">Sensory
neurons – these provide input to the CNS via the PNS. They are specialized
to respond to stimulus such as light or pressure.</li>
<li class="MsoNormal">Interneurons
– these transmit impulses within the CNS and influence the function of
other neurons.</li>
<li class="MsoNormal">Motor
neurons – of the PNS transmit impulses away from the CNS to all organs and
tissues of the body.</li>
</ul>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Neurons Initiate Action
Potentials</b></span></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b><a href="http://www.youtube.com/watch?v=YP_P6bYvEjE&feature=related" target="_blank">Click Here to view resting potential</a> </b></span></div>
<div class="MsoNormal">
<b>Sodium-potassium pump maintains resting potential</b></div>
<div class="MsoNormal">
A neuron that is capable of action potential, but is not
generating one at the moment, is a normal, or resting, membrane potential. This
means the inside of the neuron is negatively charged compared to the outside
(-70 millivolts). For every three sodium ions transported out of the cell, two
potassium ions are transported in. Every time the sodium-potassium pump goes
through a cycle, it results in the removal of one osmotic particle and one
positive charge. This and the negatively charged protein molecules that are
trapped in the cell create a slight excess of negative charge in the cell
cytoplasm than the interstitial fluid. So, sodium is higher in concentration in
the interstitial fluid than in the cytoplasm and the opposite if true for
potassium. Sodium is always leaking into the cell and potassium is always
leaking out via passive diffusion. It is the active transport of the
sodium-potassium pump that balances the rate of leakage and maintains the
membrane potential.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Graded potentials alter the resting potential</b></div>
<div class="MsoNormal">
The resting potential of a neuron changes when an impulse
arrives from another neuron. These signals may depolarize it, moving the
voltage closer to zero; or hyperpolarize it, making it more negative. These
changes are graded potentials because they can vary in size. A neuron can
receive hundreds of incoming signals at the same time and can these can add up
in space and time. This means that many incoming signals can produce bigger
changes in the membrane than just one impulse alone, referred to as summation.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>An action potential is a sudden reversal of membrane
voltage</b></div>
<div class="MsoNormal">
<b><a href="http://www.youtube.com/watch?v=R0TdXkxBOkE&feature=related" target="_blank">Click Here to view action potential</a> </b></div>
<div class="MsoNormal">
When the threshold is reached of all the graded potentials
within the membrane, action potential results. Action potential is a sudden
reversal of voltage difference across the cell membrane. It is the only way
that information is transmitted long distance via the nervous system. Once
threshold has been reached, voltage-sensitive ion channels open and close
within the axon. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
There are three steps involved in action potential:</div>
<div class="MsoNormal">
<br /></div>
<ol start="1" style="margin-top: 0in;" type="1">
<li class="MsoNormal">Depolarization:
sodium moves into the axon.</li>
<li class="MsoNormal">Repolarization:
potassium moves out of the axon.</li>
<li class="MsoNormal">Reestablishment
of the resting potential.</li>
</ol>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
While action potential is occurring, an axon cannot generate
another action potential. This is referred to as the absolute refractory
period.<span> </span>This period ensures that
action potential only travels in one direction. Right after this absolute
period is a relative refractory period, in which it is harder than usual to
generate the next action potential. And whether or not a neuron is generating
an action potential, the sodium-potassium pump continues to maintain normal concentrations
and resting potential.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Action potentials are all-or-none and self-propagating</b></div>
<div class="MsoNormal">
Action potentials can be compared to firing a gun: a certain
amount of pressure (threshold level), is required to make the gun fire. And
pressing the gun too lightly or too hard does not make the bullet leave the gun
any faster. This is the all-or-none of action potential – it either happens, or
it doesn’t. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
Action potential is also self-propagating in that it
continues to propagate itself in the next region of the axon. While impulses
move forward from one region, action potential brings the next region of the
axon to threshold. Electrical current runs continuously down the axon, moving
at a constant rate of speed and amplitude. Stronger stimuli generate more
action potentials per time unit, rather than faster or bigger ones. And though
speed is constant for a given neuron, the speed in different neurons varies
from 5 to 250 mph. </div>
<div class="MsoNormal">
<br /></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjwcrOHbnhC7UjrJp_kDfoXZ9h52z3aZ5BpGzGit_OiZW_MbhFr6jCRpQuUulu8ToMQ5ItXiLUYgDCQuR85eePPYdGAJKxbTtaq-fTeHR8Z5jVz6s3cns-H-G49IMlnA4mSb5bd7zCqyYem/s1600/neuroglialcell" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="250" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjwcrOHbnhC7UjrJp_kDfoXZ9h52z3aZ5BpGzGit_OiZW_MbhFr6jCRpQuUulu8ToMQ5ItXiLUYgDCQuR85eePPYdGAJKxbTtaq-fTeHR8Z5jVz6s3cns-H-G49IMlnA4mSb5bd7zCqyYem/s320/neuroglialcell" width="320" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">sciencephoto.com/accessed 5/7/12</td></tr>
</tbody></table>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Neuroglial Cells Support
and Protect Neurons</b></span></div>
<div class="MsoNormal">
Approximately 20 % of the cells in the human nervous system
are neurons. The rest are neuroglial cells, providing support and protection to
the neurons and helping to maintain concentrations of important chemicals in
the fluid surrounding them. These cells do not generate or transmit impulses. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
In the PNS, or peripheral nervous system, there are
specialized neuroglial cells that enclose and protect many neuron axons. These
are referred to as Schwann cells. These cells produce myelin, which is a fatty,
insulating material. These Schwann cells wrap themselves around short segments
of an axon many times, forming a blanket or myelin sheath. Between these cells
are uninsulated gaps, or nodes of Ranvier, where the surface of the axon is
exposed. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
The myelin sheath has three important functions:</div>
<div class="MsoNormal">
<br /></div>
<ol start="1" style="margin-top: 0in;" type="1">
<li class="MsoNormal">It
saves the neuron energy.</li>
<li class="MsoNormal">It
speeds up the transmission of impulses.</li>
<li class="MsoNormal">It
helps damaged or severed axons of the peripheral nervous system
regenerate.</li>
</ol>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
In the central nervous system, or CNS, the myelin sheath is
produced by a neuroglial cell called an oligodendrocyte. Unlike the Schwann
cells, the sheath formed by the oligodendrocytes degenerates once the axon it
protects is destroyed. Because of this, neurons of the CNS do not regenerate
after injury. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Information is Transferred
from a Neuron to its Target</b></span></div>
<div class="MsoNormal">
After an action potential reaches the axon terminals of a
neuron, the information must be converted to another form for transmission to
its destination (muscle cell, gland cell, or another neuron). The action
potential causes the release of a chemical that crosses a special junction
between two cells, or the synapse. We call this substance the neurotransmitter,
because it transmits the signal from the neuron to its target. This process is
call synaptic transmission.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Neurotransmitter is released</b></div>
<div class="MsoNormal">
<b><a href="http://www.youtube.com/watch?v=LT3VKAr4roo&feature=related" target="_blank">Click Here to view neuron synapse</a> </b></div>
<div class="MsoNormal">
At the synapse, the cell membrane of the neuron that is
sending the information is called the presynaptic membrane. Postsynaptic
membrane is the membrane of the receiving cell. The small fluid-filled gap
between these two membranes is the synaptic cleft. Neurotransmitters are stored
in a bulb at the end of the presynaptic neuron. Transmission follows this
pattern:</div>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal">An
action potential arrives at the bulb, causing calcium channels in the presynaptic
membrane to open and diffuse into the axon bulb.</li>
<li class="MsoNormal">The
presence of calcium causes vesicles to fuse with the presynaptic membrane,
causing the release of the neurotransmitter into the synaptic cleft. And
because the cleft is so narrow, the neurotransmitter molecules diffuse
into the postsynaptic membrane.</li>
<li class="MsoNormal">Certain
gated channels open because molecules of neurotransmitters bind to
receptors on the postsynaptic membrane.</li>
<li class="MsoNormal">Sodium
ions diffuse inward, which produces graded depolarization of the
postsynaptic membrane in the area of the synapse.</li>
</ul>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
Graded potential causes the opening of chemically sensitive
ion channels, rather than voltage-sensitive channels.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Neurotransmitters exert excitatory or inhibitory effects</b></div>
<div class="MsoNormal">
<b><a href="http://www.youtube.com/watch?feature=endscreen&v=haNoq8UbSyc&NR=1" target="_blank">Click Here to see how neurotransmitters function</a> </b></div>
<div class="MsoNormal">
The response of the postsynaptic cell depends on several
factors: type of neurotransmitter, concentration in the synaptic cleft, and the
types of receptors and chemically sensitive ion channels in the postsynaptic
membrane. Scientists have identified more than 50 chemicals that can function
as neurotransmitters. All of these are stored in vesicles within the axon bulb
and released via action potential. There are excitatory and inhibitory
neurotransmitters, as well as some that function both ways. Excitatory
neurotransmitters depolarize the postsynaptic cell, which causes threshold
approach or excess of threshold. This encourages new impulses in the
postsynaptic neuron. Inhibitory neurotransmitters cause hyperpolarization of
the postsynaptic cell (the cell becomes more negative). This in turn, prevents
action potential. Neurotransmitters that function as both are dependent on the
type of receptor they bind with on the postsynaptic membrane. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Postsynaptic neurons integrate and process information</b></div>
<div class="MsoNormal">
It is the conversion of the action potential (electrical) to
the neurotransmitter (chemical), that allows the postsynaptic cell to integrate
and process information. When one neuron receives input from many neurons, we
call this convergence. It’s action potential then goes to many other neurons,
known as divergence. Neurons do not interpret information (they do not have a
brain), but the effect of convergence is that neurons integrate and process
thousands of simultaneous incoming stimulatory and inhibitory signals before
they generate and transmit their own action potentials. They also reroute
information to many destinations. So, individual neurons cannot see, smell, or
hear, but their combined actions allow us to experience these incredible
sensations. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<style>
@font-face {
font-family: "Times New Roman";
}@font-face {
font-family: "Courier New";
}@font-face {
font-family: "Wingdings";
}p.MsoNormal, li.MsoNormal, div.MsoNormal { margin: 0in 0in 0.0001pt; font-size: 12pt; font-family: "Times New Roman"; }table.MsoNormalTable { font-size: 10pt; font-family: "Times New Roman"; }div.Section1 { page: Section1; }ol { margin-bottom: 0in; }ul { margin-bottom: 0in; }
</style>
</div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhSO5JZ-En7BElB1hiQjhyEhlTV3jUDweUnxl2A9YtPM9aJG-1FEo2s93oR1miD62myApgK7M_J3VOaaa_v6YjBaHOijexENqGUkDC7TBoLlWe2ARTy13zR_MMgyTk5OUXfYGmZkzeGAoWW/s1600/eyesclosed" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="200" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhSO5JZ-En7BElB1hiQjhyEhlTV3jUDweUnxl2A9YtPM9aJG-1FEo2s93oR1miD62myApgK7M_J3VOaaa_v6YjBaHOijexENqGUkDC7TBoLlWe2ARTy13zR_MMgyTk5OUXfYGmZkzeGAoWW/s200/eyesclosed" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">online.wsj.com/accessed 5/7/12</td></tr>
</tbody></table>
<div class="MsoNormal">
<span style="font-size: 16pt;"><b>Sensory Mechanisms</b></span></div>
<div class="MsoNormal">
Your body’s sensory mechanisms are constantly providing the
brain with detailed information about the world around you, as well as the body
itself. Try closing your eyes and listening to any sounds you can hear. Then
try to judge how far away they are and what direction they are coming from.
Lets explore how different kinds of sensory information are received by your
body, converted to nerve impulses, and transmitted to the brain in a way that
actually makes sense.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Receptors receive and
convert stimuli</b></span></div>
<div class="MsoNormal">
The sensory input that causes change within or without your
body is referred to as stimuli. Stimuli can be heat, pressure, sound waves, or
chemical. Receptors, structures specialized in receiving stimuli, accept and
convert the stimuli energy into another form. Some receptors convert stimuli
into graded potential and if powerful enough, generates an impulse within the
sensory neuron. Other receptors are a part of cells that produce graded
potentials and release a neurotransmitter, stimulating nearby sensory neurons.
However it is done, the effect is the same, generating an impulse in a sensory
neuron. When the CNS receives these impulses, many times we experience a
sensation, becoming consciously aware of the stimulus. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Receptors are classified according to stimulus</b></div>
<div class="MsoNormal">
<b><a href="http://www.youtube.com/watch?v=IC3YTJNu0Ec" target="_blank">Click Here to view sensory receptors</a> </b></div>
<div class="MsoNormal">
Classification of receptors is done according to the type of
stimulus energy they convert:</div>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal">Mechanoreceptors:
respond to forms of mechanical energy, such as sound waves, fluid
pressure, physical touch, etc..</li>
<li class="MsoNormal">Thermoreceptors:
response to heat and cold</li>
<li class="MsoNormal">Pain
receptors: respond to tissue damage or excessive pressure or temperature.</li>
<li class="MsoNormal">Chemoreceptors:
respond to the presence of chemicals.</li>
<li class="MsoNormal">Photoreceptors:
respond to light.</li>
</ul>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
Many receptors contribute to sensation. A few are “silent”
receptors (we are not consciously aware of their actions). These function in
negative feedback loops that maintain homeostasis inside our bodies. </div>
<div class="MsoNormal">
<br /></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEin36A4jgCFhx6icc0MgYGGI895nlcwtHzZwd8AeBjs3qzHZs_Nq-KNd9pKqhyphenhyphen9hgvMyKqVRQdDe_GdwGJa9tJjNHtxrHDqzqwYTBozccwiDV0zfhZeABHBLlBE_XgYgEeCQB_05ONbJu8i/s1600/sensory" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="320" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEin36A4jgCFhx6icc0MgYGGI895nlcwtHzZwd8AeBjs3qzHZs_Nq-KNd9pKqhyphenhyphen9hgvMyKqVRQdDe_GdwGJa9tJjNHtxrHDqzqwYTBozccwiDV0zfhZeABHBLlBE_XgYgEeCQB_05ONbJu8i/s320/sensory" width="241" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">rci.rutgers.edu/accessed 5/7/12</td></tr>
</tbody></table>
<div class="MsoNormal">
<b>The CNS interprets nerve impulses based on origin and
frequency</b></div>
<div class="MsoNormal">
Nerve impulses are transmitted from receptors to specific
brain areas.<span> </span>This is how the CNS
can interpret and distinguish incoming impulses. For example, visual stimuli
travel in sensory neurons whose axons go directly to regions in your brain associated
with vision. All of these incoming impulses are interpreted as light,
regardless of how they were initiated. So the central nervous system gets all
the information it needs by monitoring where the impulse originates and their
frequency.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Some receptors adapt to continuing stimuli</b></div>
<div class="MsoNormal">
The CNS is able to ignore one sensation over another. And
some receptors can ignore sensory input after a short time due to receptor
adaptation – the sensory neuron stops sending impulses even though the stimulus
is still present. Receptors in the skin and olfactory adapt fairly quickly.
Some receptors such as pain, joint, muscle and all silent receptors, adapt very
slowly or not at all. This is critical to our survival. It allows us to act
appropriately when ill or injured and allows our bodies to maintain homeostasis.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Somatic sensations and special senses provide sensory
information</b></div>
<div class="MsoNormal">
Sensations provided by receptors are either somatic or
special. Somatic sensations originate from receptors at more than one location
in the body. These sensations include temperature, touch, vibration, pressure,
pain, and awareness of body movement and position. There are five special
senses (taste, smell, hearing, balance, and vision) that originate from
restricted areas of the body. They deliver very specialized information.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Somatic Sensations Arise
from Receptors Throughout the Body</b></span></div>
<div class="MsoNormal">
The receptors for somatic sensations are located throughout
your body in skin, joints, skeletal muscles, tendons, and internal organs. The
sensory neurons that are linked to these receptors send impulses to the
somatosensory area of the parietal lobe of the cerebral cortex in the brain.
This area processes the information and sends it to the primary motor area in
the frontal lobe. Then, if necessary, impulses are generated in motor neurons
of the PNS to cause body movement.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Mechanoreceptors detect touch, pressure, and vibration</b></div>
<div class="MsoNormal">
<b><a href="http://www.youtube.com/watch?v=OB-vjStPR8Q&feature=results_video&playnext=1&list=PL64CD107F6A24BE89" target="_blank">Click Here to view several videos on mechanoreceptors</a> </b></div>
<div class="MsoNormal">
Mechanoreceptors are modified dendritic endings of sensory
neurons. Any force that changes the form of the plasma membrane of the
dendritic ending produces a graded potential. If the graded potential is large
enough that is exceeds threshold, the sensory neuron initiates an impulse.
These receptors vary in location, the degree to which they adapt, and the
intensity of stimulus required to generate an impulse. Here are several examples
of different types of receptors in the skin that detect somatic sensations:</div>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal">Unencapsulated
dendritic endings – around hairs and near the skin surface. Signal pain,
light pressure and changes in temperature.</li>
<li class="MsoNormal">Merkel
disks – located in the epidermis. Unecapsulated, detect light pressure and
touch.</li>
<li class="MsoNormal">Meissner’s
corpuscles – located just under the epidermis, at the top of the dermis.
Encapsulated, detect the beginning and end of light pressure.</li>
<li class="MsoNormal">Ruffini
endings – in the center of the dermis. Encapsulated, they respond to
ongoing pressure.</li>
<li class="MsoNormal">Pacinian
corpuscles – encapsulated endings in connective tissue within the dermis.
Respond to deep pressure or high-frequency vibration.</li>
</ul>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Mechanoreceptors indicate limb position, muscle length,
and tension</b></div>
<div class="MsoNormal">
You can tell the positions of your limbs via
mechanoreceptors located in joints (joint position), skeletal muscles (length),
and tendons (tension). Best known are the muscle spindles, which monitor muscle
length. Muscle length, for the most part, determines joint position because of
the way it is attached to the bone. Mechanical distortion of the
mechanoreceptors causes local graded potentials in the dendritic endings, and
if threshold is passed, action potential is produced. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Thermoreceptors detect temperature</b></div>
<div class="MsoNormal">
Thermoreceptors, near the skin surface, provide information
about the external environment. They adapt quickly, which allows us to monitor
changes in temperature, and yet adjust sensory input so it becomes more
bearable. For example, when you step into a hot shower, it is uncomfortable at
first, but your body adjusts to it after a few moments. There are other
thermoreceptors located in the abdominal and thoracic organs that monitor
internal temperature, maintaining homeostasis.</div>
<div class="MsoNormal">
<br /></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiTIRwu-c5v6BaOqpP8OKydC0qXdf4NXmQJSOWzoJ1vzyr7YK-8BSv8i8DErrReTlK4C2q_DLtZWgDjC41eevx57rLaytyRogEOUNxHrPJ9-f6O9sMTWQVLUHtyu8mBPxZnpcl55y6Jm4x4/s1600/pain" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="200" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiTIRwu-c5v6BaOqpP8OKydC0qXdf4NXmQJSOWzoJ1vzyr7YK-8BSv8i8DErrReTlK4C2q_DLtZWgDjC41eevx57rLaytyRogEOUNxHrPJ9-f6O9sMTWQVLUHtyu8mBPxZnpcl55y6Jm4x4/s200/pain" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">valadservices.com/axccessed 5/7/12</td></tr>
</tbody></table>
<div class="MsoNormal">
<b>Pain receptors signal discomfort</b></div>
<div class="MsoNormal">
There are two types of pain: fast pain (sharp or acute),
occurs a tenth of second after the stimulus. The reflex withdrawal response to
fast pain is strong and rapid. Slow pain may not appear until seconds or even
minutes after injury. This is due to the activation of chemically sensitive
pain receptors by chemicals released from damaged tissue. Referred pain, is
slow pain from internal organs, often perceived as originating from an area of
the body that is completely different from the source of origination. This happens
because action potentials from internal pain receptors are transmitted via the
same spinal neurons that transmit action potentials from pain receptors in the
skin and skeletal muscles to the brain. Our brains have no way to determine the
exact sourcem so it assigns pain to another location. Pain receptors do not
generally adapt, which is beneficial for survival. However, that also means
that people with chronic diseases or disabilities often experience constant
discomfort. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Vision: Detecting and
Interpreting Visual Stimuli</b></span></div>
<div class="MsoNormal">
Electromagnetic radiation, or light, travels at a speed of
186,000 miles per second in waves. Our eyes actually allow is to receive and
process light. We can detect objects from near or far, and from dim or bright
sources. Light is collected and focused onto specialized cells within our eyes,
called photoreceptors.</div>
<div class="MsoNormal">
<br /></div>
<table align="center" cellpadding="0" cellspacing="0" class="tr-caption-container" style="margin-left: auto; margin-right: auto; text-align: center;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhlvNyNVFL68BQJt9Jy4By10vPzB7MePAwvPSWv2qVcEWUVs3MVL4jCv6ahtV8kDr49NGn7xzK7ca-fwqQiKQGRgF0o4T1hVJYUMdNB3ut9kvg9JqlHUpSC3zv3jFEMqYC4n5ip-bElZ7Kr/s1600/theeye" imageanchor="1" style="margin-left: auto; margin-right: auto;"><img border="0" height="270" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhlvNyNVFL68BQJt9Jy4By10vPzB7MePAwvPSWv2qVcEWUVs3MVL4jCv6ahtV8kDr49NGn7xzK7ca-fwqQiKQGRgF0o4T1hVJYUMdNB3ut9kvg9JqlHUpSC3zv3jFEMqYC4n5ip-bElZ7Kr/s320/theeye" width="320" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">well-health366.blogspot.com/accessed 5/7/12</td></tr>
</tbody></table>
<div class="MsoNormal">
<b>Structure of the eye</b></div>
<div class="MsoNormal">
The sclera is the tough outer coat, or the “white of the eye”,
and covers the outer surface except in front, where it is the clear cornea.
Light passes through the cornea and aqueous humor (space filled with fluid that
nourishes and cushions the cornea and lens). Light then hits either the iris (a
colored, disk-shaped muscle), or passes through the pupil (an adjustable
opening in the center of the iris). If light passes through the pupil, it
strikes the lens, a transparent, flexible structure attached with connective
tissue fibers to a ring of smooth muscle, or ciliary muscle. After light passes
through the main chamber, it hits the retina, on the back and sides of the eye.
The retina is made of photoreceptors, neurons, and blood vessels. At the back
is the optic nerve, which carries information to the thalamus, and then on to
the visual cortex for interpretation. The skeletal muscles surrounding the eye control
movements, letting us look where we want to. The macula, or central region of
the retina, has the highest density of photoreceptors. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Regulating the amount of light and focusing the image</b></div>
<div class="MsoNormal">
There are two sets of smooth muscle that adjust the amount of
light entering the eye. When there is bright light, the muscles arranged
circularly around the pupil causes the pupil to contract. If this did not take
place, daylight would overpower our photoreceptors and temporarily blind us. In
dim light, smooth muscle arranged radially around the pupil, causes the pupil
to dilate. It is our nerves that control these muscles. The cornea and lens
focus the light that enters. Because our cornea is curved, it bends most of the
incoming light. But because the curvature is not adjustable, the degree to
which light is bent is controlled by the ciliary muscle. When this muscle
contracts, the tension on the fibers attached to the lens is reduced, which
allows focus on near objects. The reverse it true for focus on distant objects.
This is referred to as accommodation. As light rays form each point of an
object are bent and focused, the image on the retina is inverted. But our brain
interprets it as right side up. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Eyeball shape affects focus</b> </div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEitQb1FZOCSyyaU1jH_HkYlZyrL9LkS78I3c65VQMsTHGJINZfIEYy6vvpvtFO-3HQMuqqwap812Daa-fxvy1grpGUOcUrQpebp3tSyQtfPd94ypFfU9G8DFmfWjLXoPa6YYaNcIF9SAckz/s1600/Astigmatism+" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="187" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEitQb1FZOCSyyaU1jH_HkYlZyrL9LkS78I3c65VQMsTHGJINZfIEYy6vvpvtFO-3HQMuqqwap812Daa-fxvy1grpGUOcUrQpebp3tSyQtfPd94ypFfU9G8DFmfWjLXoPa6YYaNcIF9SAckz/s200/Astigmatism+" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">lasikeye.com/accessed 5/7/12</td></tr>
</tbody></table>
<div class="MsoNormal">
Our ability to focus properly can be affected by the shape
of our eyeball. People with myopia (an inherited condition) have an eyeball
slightly longer than normal. (Myopia can also be caused by the ciliary muscle
contracting too strongly). This causes distant objects to focus in front of the
retina, which means that distant objects are out of focus. This is referred to
as nearsightedness and can be corrected with concave lenses. Hyperopia
(farsightedness) occurs when the eyeball is too short. This causes nearby
objects to focus behind the retina, so nearby objects are out of focus. Convex
lenses will correct this. Then there is astigmatism (blurred vision), caused by
irregular shape of the cornea or lens. This causes the light to scatter, not
focusing evenly on the retina. Astigmatism can also be <a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEitQb1FZOCSyyaU1jH_HkYlZyrL9LkS78I3c65VQMsTHGJINZfIEYy6vvpvtFO-3HQMuqqwap812Daa-fxvy1grpGUOcUrQpebp3tSyQtfPd94ypFfU9G8DFmfWjLXoPa6YYaNcIF9SAckz/s1600/Astigmatism+" style="clear: left; float: left; margin-bottom: 1em; margin-right: 1em;"></a>corrected with specially
ground lenses.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Light is converted into action potentials</b></div>
<div class="MsoNormal">
It is our retina that converts light (stimulus) into
impulses. It allows us to see in color, perceive images, and adapt to different
light intensities. The retina is made of four layers:</div>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal">Outermost
layer – pigmented cells and choroid. Absorbs light not captured by
photoreceptor cells.</li>
<li class="MsoNormal">2<sup>nd</sup>
layer – photoreceptor cells (rods and cones).</li>
<li class="MsoNormal">3<sup>rd</sup>
layer – bipolar cells (neurons). Partially process and integrate
information before passing it along to the 4<sup>th</sup> layer.</li>
<li class="MsoNormal">Innermost
layer – ganglion cells (neurons). The long axons of the ganglion cells
become the optic nerve running to the brain. </li>
</ul>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Rods and cones respond to light</b></div>
<div class="MsoNormal">
<b><a href="http://www.youtube.com/watch?v=W-yLfm5HsHc&feature=related" target="_blank">Click Here to view Rods and Cones</a> </b></div>
<div class="MsoNormal">
Rods and cones are flattened disks that contain numerous photopigment
molecules. These molecules are a light-sensitive protein. This protein changes
shape when exposed to energy (in the form of light). This change in shape
causes some of the sodium channels to close, which reduces the amount of
neurotransmitter normally released. Neurotransmitter normally inhibits bipolar
cells. So ultimately light increases bipolar cell activity, which then
activates ganglion cells. There are approximately 120 million rods, 6 million
cones, and 1 million ganglion cells with axons going to the brain. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Rods provide vision in dim light</b></div>
<div class="MsoNormal">
As seen above, there are about 20 times more rods than
cones. So if we imagine all 120 rods converging on half of the ganglion cells
(half a million), that means there would be 240 rods converging on a single
ganglion cell. The convergence increases our ability to see in dim light, but
without detail or accuracy. This is due to the fact that rods have photopigment
called rhodopsin. Rhodopsin is more sensitive to light, than the photopigment
in cones. So rods are primarily responsible for dim light vision, but they do
not give us color vision, which explains why objects appear less colorful in
dim light. Neither are rods and cones distributed evenly on the retina. Regions
farthest away from the fovea have the highest ratio of rods to cones. So if you
want to see a dim star at night, rather than looking directly at it, adjust
your vision to look just off the side.</div>
<div class="MsoNormal">
<br /></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiTrjL_WOXBG09U0GyEscsI0L1AIZFvs7KZslExrEqpnO2dJTbzYb6-Kzs-3BpwfIrc5ICvKbVUpwmRvwuQfq3TYuS7KghDKWcchHFmYVE9cqxtsG3_qmLes4cpFwPu7RcsE2v-SGYDAlA-/s1600/rodsandcones" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="197" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiTrjL_WOXBG09U0GyEscsI0L1AIZFvs7KZslExrEqpnO2dJTbzYb6-Kzs-3BpwfIrc5ICvKbVUpwmRvwuQfq3TYuS7KghDKWcchHFmYVE9cqxtsG3_qmLes4cpFwPu7RcsE2v-SGYDAlA-/s200/rodsandcones" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">sciencephoto.com/accessed 5/7/12</td></tr>
</tbody></table>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Cones provide color vision and accurate images</b></div>
<div class="MsoNormal">
Cones allow us to see color because there are three
different kinds: red, green, and blue. Each one contains a photopigment that
absorbs energy from red, green, and blue light. The ability to distinguish
various colors is due to the way our brain interprets the ratio of impulses
that come from the ganglion cells that are connected to the cones. When all
three are activated, we perceive white light. Whereas black is no light at all.
It is the cones that are also responsible for visual acuity. Cones require
stronger light to activate, which is why it is harder to distinguish color in
dim light.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Visual receptors adapt</b></div>
<div class="MsoNormal">
As we all know, vision adapts to changing light. It usually
takes longer when going from bright to dim light than the other way around.
This adaptation depends on rapid adjustment of the pupil by the iris and
adaptation by the rods. The absorption of light via rhodopsin uses up the
photopigment temporarily. Light energy breaks rhodopsin into two molecules.
They can be resynthesized, but it takes a moment. When you have been in bright
light, most of the rhodopsin has been broken down. So when you enter a dim room
next, the cones are not functioning at first. When you go out into sunlight
after being in a dim room, the light is very bright because you have the
maximum amount of photopigment available in both the rods and cones. But then
the rhodopsin is quickly used up, so you are using mainly cones in bright
light.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Disorders of Sensory
Mechanisms</b></span></div>
<div class="MsoNormal">
<b>Disorders of the ear</b></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEipIKk-ivpVLXgY4Y0os1c_0sZJJiY13xVZGC64kbEjd2VkcvxKF2pOjn4hGjas57zD_JMFTujFMv9JXJOjvr9Vd4xGa1rfJsEuXopQ7ltyr6aA3BwH7F10kBCFzuh7SVK2yxrLLRsQ82wN/s1600/tympanicmembrane+" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEipIKk-ivpVLXgY4Y0os1c_0sZJJiY13xVZGC64kbEjd2VkcvxKF2pOjn4hGjas57zD_JMFTujFMv9JXJOjvr9Vd4xGa1rfJsEuXopQ7ltyr6aA3BwH7F10kBCFzuh7SVK2yxrLLRsQ82wN/s1600/tympanicmembrane+" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">tympanic memebrane/cornellent.org/accessed 5/7/12</td></tr>
</tbody></table>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal">Deafness
(loss of hearing) – nerve deafness is caused by damage to the hair cells.
Is usually caused by frequent exposure to loud sounds. Conduction deafness
is caused by damage to the tympanic membrane or bones of the middle ear.
Conduction deafness is most often due to arthritis of the middle ear
bones. </li>
</ul>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal">Otitis
media (inflammation of the middle ear) – a common cause of earaches.
Usually due to upper respiratory tract infections.</li>
</ul>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal">Meniere’s
syndrome (inner ear condition that impairs hearing and balance) – this is
a chronic condition with cause unknown, though it may be due to excess
fluid in the cochlea and semicircular canals. It affects balance and
hearing. (I happen to have Meniere’s syndrome – it can be very
debilitating).</li>
</ul>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Disorders of the eyes</b></div>
<div class="MsoNormal">
<b><a href="http://www.youtube.com/watch?v=oliqVW0yyHE" target="_blank">Click Here to learn about diagnosing disease through the eye exam</a> </b></div>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal">Retinal
detachment (retina separates from choroid) – most commonly caused by a
blow the head. The retina tears and vitreous humor leaks through and peels
the retina away from the choroid. Prompt surgery can usually repair the
damage.</li>
</ul>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal">Cataracts
(the lens becomes opaque) – can be congenital, but most often is age
related or associated with diabetes. Delivery of nutrients to the lens
becomes insufficient causing proteins to clump, making the lens less
transparent and eventually opaque. Surgery to replace the lens with an
artificial one can repair the problem, if successful.</li>
</ul>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal">Glaucoma
(pressure inside the eye rises) – the canal of Schlemm, the drainage
vessel for aqueous humor, becomes blocked. The excess fluid increases
pressure and compresses blood vessels. If detected early enough, can be
controlled with drugs or surgery before permanent damage is done, although
any lost site prior to that will not be recovered.</li>
</ul>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal">Age-related
macular degeneration (AMD) – visual impairment caused by detachment of the
retina and degeneration of photoreceptor cells in the macular region of
the retina. Can be caused by an accumulation of cellular debris between
the choroids and retina or abnormal growth of blood vessels in the region.
No effective cure yet, however, vascular growth factors and vitamin
treatments are showing promise at slowing or delaying progression of the
disease.</li>
</ul>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal">Color
blindness (inability to distinguish the full range of colors) – most
commonly caused by deficient numbers of a particular type of cone. Rarer,
is the inability to perceive any color. This happens when two of the three
cones are missing completely. Often inherited, red-green blindness is an
X-linked recessive trait.</li>
</ul>
<br />
<style>
@font-face {
font-family: "Times New Roman";
}p.MsoNormal, li.MsoNormal, div.MsoNormal { margin: 0in 0in 0.0001pt; font-size: 12pt; font-family: "Times New Roman"; }table.MsoNormalTable { font-size: 10pt; font-family: "Times New Roman"; }div.Section1 { page: Section1; }
</style>
<br />
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiVCvkU2Vd8rHVahpe77vmi-ORX9cD3PE2zE-MhpwPw_kOhorUnwu2RLUj54RuuNS7DRiAxVfj9CkWvgdA5xBfTnzbz0UlwG2REGRNoWz9W-qg8LpXihVfa-lYdQzfHAbU4LYnoKMO8txnP/s1600/worldissues" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiVCvkU2Vd8rHVahpe77vmi-ORX9cD3PE2zE-MhpwPw_kOhorUnwu2RLUj54RuuNS7DRiAxVfj9CkWvgdA5xBfTnzbz0UlwG2REGRNoWz9W-qg8LpXihVfa-lYdQzfHAbU4LYnoKMO8txnP/s1600/worldissues" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">nfty.rjblog.org/accessed 5/7/12</td></tr>
</tbody></table>
<div class="MsoNormal">
<span style="font-size: 16pt;"><b>Human Impacts,
Biodiversity, and Environmental Issues</b></span></div>
<div class="MsoNormal">
The impact that we, as humans, have on our environment can
be either destructive or beneficial. Our presence has definitely altered air,
water, and land, both in local and global ecosystems. Let take a look at some
of the issues…</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Pollutants Impair Air
Quality</b></span></div>
<div class="MsoNormal">
Pollution is the trace amounts of thousands of chemicals in
the air that have adverse effects on living organisms. The major concerns fall
into four categories:</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Excessive greenhouse gases lead to global warming</b></div>
<div class="MsoNormal">
Inside a greenhouse, sunlight penetrates, is converted to
heat, and becomes warmer because the heat cannot escape. The same thing is
happening on earth in the upper layers of the atmosphere with certain
gases.<span> </span>This gas is made of water
vapor, carbon dioxide (CO2), methane (CH4), nitrous oxide (N2O),
chlorofluorocarbons (CFCs), and halons that contain bromine. Together, these
gases produce the greenhouse effect. This process is normal, maintaining
earth’s surface temperature. But human activities have increased the levels of
greenhouse gases, especially CO2.<span>
</span>This is raising the average global temperature, or, global warming. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
The two things that contribute the most to global warming is
the burning of fossil fuels for energy and deforestation. (Trees absorb CO2
from the air during photosynthesis. A large tree can store 50lb of CO2 every
year). When we burn trees, it is double the damage because the carbon in the
wood is released back into the atmosphere.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>CFCs deplete the ozone layer</b></div>
<div class="MsoNormal">
<b><a href="http://www.youtube.com/watch?v=qUfVMogIdr8&feature=related" target="_blank">Click Here to explore the ozone problem</a> </b></div>
<div class="MsoNormal">
Ozone (O3) is in the troposphere and stratosphere. In the
troposphere is the layer of pollution we see from automobile exhaust and
industrial pollution. It is mildly toxic, causing plant damage and respiratory
distress in all animal life, including humans. Higher up in the stratosphere,
ozone is beneficial, creating a shield from ultraviolet rays. But in the early
1980’s, it was discovered that CFCs (a group of chemicals used in
refrigerators, air conditioners, and aerosol sprays) had migrated upward,
decomposed, and released chlorine atoms. These atoms combine with ozone,
destroy it, and create oxygen. And because the chlorine atom can be reused in
this reaction, one chlorine atom can destroy as many as 10,000 ozone molecules.
By 1985, scientists began to see holes in the ozone layer. Quick action by the
international community has halted the damage, but it will take 100-150 years
before the ozone layer returns to normal.</div>
<div class="MsoNormal">
<br /></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjrPI0wCZDuEDRp42espy2o0_CCRLUvORd5zIhtKE2yxoO6_37ElUSEgZSc2Vf2OJ5EyGpAdb8DSeeJM0pGXEztklt_xy2Sp84c00L78e2xoyOdQV-kpxc5hcqQRYoyHQYN6Rmkw4iPqsew/s1600/acidrain" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="225" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjrPI0wCZDuEDRp42espy2o0_CCRLUvORd5zIhtKE2yxoO6_37ElUSEgZSc2Vf2OJ5EyGpAdb8DSeeJM0pGXEztklt_xy2Sp84c00L78e2xoyOdQV-kpxc5hcqQRYoyHQYN6Rmkw4iPqsew/s320/acidrain" width="320" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">effectsofacidrain/gettyimages.com/accessed 5/7/12</td></tr>
</tbody></table>
<div class="MsoNormal">
<b>Pollutants produce acid precipitation</b></div>
<div class="MsoNormal">
Acid precipitation is caused when sulfur dioxide is released
into the air via burning coal and oil, and nitrogen oxide released via
automobile exhaust. These oxides combine with water vapor in the air and become
sulfuric and nitric acid, which then dissolve in raindrops, which fall as acid
precipitation. This corrodes metal and stone and damages forests and aquatic
ecosystems. There have been steps taken to remove sulfur from coal burning
power plants and as a result, by 1985, sulfur in rainwater had declined by 33%
across most of the U.S. Northeast. Recent regulatory actions are expected to
eliminate most of the remaining sulfur emissions by 2014.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Smog blankets industrial areas</b></div>
<div class="MsoNormal">
There are several pollutants that react with each other in
sunlight and water vapor. The worst ones are nitrogen oxides and hydrocarbons.
This forms a hazy brown or gray layer of smog (term from “smoke” and “fog”).
Most smog is caused by the burning of fossil fuels and automobile exhaust. The
chemicals in smog can irritate the eyes and lungs and may lead to chronic illnesses
such as asthma and emphysema. Cleanup efforts have significantly improved some
areas, but there are still cities that have not yet solved the problem.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Pollution Jeopardizes
Scarce Water Supplies</b></span></div>
<div class="MsoNormal">
There are three major activities that affect water quality
and availability: excessive use, replacing natural vegetation with buildings
and roads, and polluting sources of water.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Water is scarce and unequally distributed</b></div>
<div class="MsoNormal">
Although water is a renewable resource in that it is always
evaporating from oceans and falls on land as rain or snow, the freshwater on
land and its aquifers, make up less than 1% of Earth’s total water.
Ninety-seven percent is salty ocean and 2% are glaciers and polar ice caps. So
it is somewhat scarce and it is not evenly disturbed throughout human
populations. Industrialized nations use 10-100 times more water than less
industrialized areas. There are already some desert and semiarid regions that
have reached their capacity. Water rights are controversial and we have already
had to make some choices between irrigating crops, supplying growing cities,
and encouraging the reproduction of Pacific salmon.</div>
<div class="MsoNormal">
<br /></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgk6akD0wtnyDrnGDKpXdRaREMjCjRHaYQopCUBBRMIhsMSn_pelsDMjpqqpRD29nuoqtOvfIgU18u6aR0USnUJvrkXoB8kj67fyLeYshMG6iauv-5oKFUbNluqLxUDO3TBcs3toHniPZej/s1600/waterrunoff" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="293" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgk6akD0wtnyDrnGDKpXdRaREMjCjRHaYQopCUBBRMIhsMSn_pelsDMjpqqpRD29nuoqtOvfIgU18u6aR0USnUJvrkXoB8kj67fyLeYshMG6iauv-5oKFUbNluqLxUDO3TBcs3toHniPZej/s400/waterrunoff" width="400" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">co.henry.ga.us/accessed 5/7/12</td></tr>
</tbody></table>
<div class="MsoNormal">
<b>Urbanization increases storm water runoff</b></div>
<div class="MsoNormal">
Because urban areas have shifted to roads and buildings
instead of fields and woods, stormwater runoff has become a problem. On the
east coast in the U.S., stormwater combines with sewage (CSO), which causes
sewage overflow, and this in turn, overwhelms streams and oceans. In the New
York harbor, 28 billion gallons of CSO flow into it every year. It is a major
source for bacteria, causing eye and ear infections, gastroenteritis, skin
rashes, respiratory infections, and hepatitis in swimmers and kayakers. On top
of that problem, pipes used to transport stormwater leads to stream overflow
during storms and low water levels during dry periods. This is causing erosion
of the streambeds and we are losing aquatic life. There are efforts underway to
stabilize stream channels, reducing erosion and restoring life.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Human activities pollute freshwater</b></div>
<div class="MsoNormal">
Many of our human activities pollute water or soil –
untreated sewage, chemicals from factories, runoff from pesticides and
fertilizers, and rubber and oil from city streets – all have to go somewhere.
They either degrade chemically or they pollute water and soil. Some water
pollutants are organic nutrients, coming from sewage treatment plants,
food-packing plants or paper mills. When they degrade by bacteria, the rapid
growth of the bacteria depletes water of oxygen, threatening wildlife. Then
there are inorganic nutrients, for example, nitrate and phosphate fertilizers
and sulfate in laundry detergent. These cause rapid growth of algae, which dies
and is decomposed by bacteria. Rapid growth of plant life and the death of
animal life in a shallow body of water via excessive organic and inorganic
nutrients is termed eutrophication. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
Then you have toxic pollutants such as polychlorinated
biphenyls (PCBs), oil and gasoline, pesticides, herbicides, and heavy metals.
These remain in our environment for a long time because they do not decompose.
Because animals eat many times over their own weight in food, their tissues
become more concentrated the higher up the food chain, or biological
magnification. One example of this is the metal mercury. Mercury often ends up
in aquatic ecosystems and is consumed by shark, tuna, and whales. And human
consumption can be dangerous, especially in pregnant women and children.
Overloading on mercury can cause loss of coordination, decreased memory and
intellect, and poor immune function.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
Other worldwide water pollutants include disease-causing
organisms that can cause typhoid fever and hepatitis, sediments from soil
erosion, nitrogen fertilizers, and heat pollution. Do you think we get the
picture yet?<span> </span></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Groundwater pollution may impair human health</b></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi_z3I9o9YPXSUOiNtGgDDxkG7r6SCDNsRNzcgGE0IWEVGeJjBKIZ4b27UAY9gHAQjej3Zp5JM0K145xCLXzBino2Oh_SRmO8D9aiQVsmqyvu12L3qHDIYLmSddxm0AAFKugI2hH1INbZeY/s1600/wastedisposal" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="140" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi_z3I9o9YPXSUOiNtGgDDxkG7r6SCDNsRNzcgGE0IWEVGeJjBKIZ4b27UAY9gHAQjej3Zp5JM0K145xCLXzBino2Oh_SRmO8D9aiQVsmqyvu12L3qHDIYLmSddxm0AAFKugI2hH1INbZeY/s200/wastedisposal" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">consciouslifestyleradioblog.com/accessed 5/7/12</td></tr>
</tbody></table>
<div class="MsoNormal">
The same pollutants that threaten surface water, also
pollute groundwater. But there are two more additional concerns. One,
groundwater is usually drinking water and may affect human health very quickly.
And two, groundwater is a slow exchanging pool, so once polluted, it may stay
that way for a long time. Right now, it is estimated that as much as 50% of all
water systems and rural wells are contaminated with some sort of pollutant.
Public officials suspect that pollutants contribute to miscarriages, skin
rashes, nervous disorders, and birth defects. Of special concern is the
disposal of radioactive waste. Radioactive waste remains radioactive for
thousands of years. Some radioactive wastes are now incorporated into glass and
then buried deep underground. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Oil pollution damages oceans and shorelines</b></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjVtuhw9thbbNqPZRUJFe3GI96vTD3euRU0HMB44HX755KP6bUHuewk1IOEr0vJo-v87L41KPeTzBYbH7gGMNAW9aF7TwwOQa5plFfhjqHYrzS4ilBBar7_M8hqx_tySwHm74xMAvKJLgaA/s1600/oilspill" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="198" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjVtuhw9thbbNqPZRUJFe3GI96vTD3euRU0HMB44HX755KP6bUHuewk1IOEr0vJo-v87L41KPeTzBYbH7gGMNAW9aF7TwwOQa5plFfhjqHYrzS4ilBBar7_M8hqx_tySwHm74xMAvKJLgaA/s320/oilspill" width="320" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">katu.com/accessed 5/7/12</td></tr>
</tbody></table>
<div class="MsoNormal">
In most years, although 2010 may be an exception, several
million tons of oil enters the world’s oceans. About 50% comes from natural
seepage, 30 % by oil disposal on land that is washed into the sea, and 20% from
accidents at sea. In general, about a quarter of oil spilled at sea is
evaporated, half is degraded by bacteria and the rest settles on the ocean
floor. But in the short term, and especially if spilled close to shore, it
causes major damage to marine and shoreline ecosystems. Even when we try to
clean up a spill, salvaging the ecosystem somewhat, it ends up in either land,
if buried, or the air, if burned. The largest oil spill in U.S. history in 2010
will be felt for decades to come. No one knows the full extent of the
environmental and economic damage from just that one spill. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Pollution and Overuse
Damage the Land</b></span></div>
<div class="MsoNormal">
Although we pollute our land, the biggest concern may be
overuse of it. We strip mountaintops to find coal, cut down forests for lumber
or to clear space for crops, and dam river valleys to produce hydroelectric
power. The U.S. alone consumes 22 tons of fuels, metals, minerals, and biomass
(food and forest products) for every person, every year. Then add to that the
amount of earth we move to build and find energy and erosion of soil due to
agriculture and forestry, and now it is almost 88 tons per person, per year. </div>
<div class="MsoNormal">
<br /></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhNqKsFrdZQyECYo5GK9Bj61dIOE1xIqjqGVXhXUSQwLzAw69ZXvdEmI2s60bskaf1rYqZNaHf27TdaOWkjvT5efC0dlI1SW_kix_myIFyeYN1-1QB921zDBvWxGqdBWBkl_keZDzJLzvgj/s1600/desertification" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="213" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhNqKsFrdZQyECYo5GK9Bj61dIOE1xIqjqGVXhXUSQwLzAw69ZXvdEmI2s60bskaf1rYqZNaHf27TdaOWkjvT5efC0dlI1SW_kix_myIFyeYN1-1QB921zDBvWxGqdBWBkl_keZDzJLzvgj/s320/desertification" width="320" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">desertification/oceanworld.tamu.edu/accesed 5/7/12</td></tr>
</tbody></table>
<div class="MsoNormal">
Human activities have altered nearly a third of Earth’s land
mass. Cities expand to nearby farmland where it is fairly flat, even though
only a small amount of the earth’s surface is suitable for farmland. Cities
require huge quantities of water and power and generate waste and pollution in
a fairly small area. In rural areas, more than half the population of the world
lives in rural poverty. They cut down all trees for fuel and shelter and
overgraze their lands with livestock. All of this leads to erosion and
desertification – the transformation of marginal land into near-desert
conditions. Every year, 15 million acres becomes desert, where it was once
productive. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
Wars also cause environmental damage ie… Iraq drained their
marshlands, which resulted in loss of valuable farmland. And this is just one
example. There is also the issue of how we dispose of our garbage. </div>
<div class="MsoNormal">
</div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>My Summary</b></span> </div>
<div class="MsoNormal">
<b><a href="http://www.youtube.com/watch?v=mBOK6y60qNY&feature=related" target="_blank">I think this video says it all, please click here</a></b></div>
<div class="MsoNormal">
In summary, what in the world have we done to our planet?
(And continue to do, I might add). It seems to me that our efforts to salvage
things has possibly come a little too late. We may be able to fix some things,
but the impact of some of our pollution, I’m afraid, is going to have very
far-reaching consequences for years and years to come. I am more than saddened by the fact that we
have not taken very good care of something that I feel we were entrusted with.
(I have cried each time I have gotten to this chapter) Sometimes, when I am out shooting photos, I sense that this earth is tired. I
know that doesn’t sound too rational, but I feel it, nevertheless. And if I
could, I would ask it and God’s forgiveness and heal it of all the damage we’ve
done to it. </div>
<br /><br />
<br />Vickihttp://www.blogger.com/profile/06412364992060613157noreply@blogger.com0tag:blogger.com,1999:blog-7781582437417706765.post-23680829246165530242012-04-12T18:44:00.001-07:002012-04-12T18:44:27.137-07:00Human Biology: Chicken Leg Dissection Lab Project/Unit 3<style>
@font-face {
font-family: "Times New Roman";
}p.MsoNormal, li.MsoNormal, div.MsoNormal { margin: 0in 0in 0.0001pt; font-size: 12pt; font-family: "Times New Roman"; }a:link, span.MsoHyperlink { color: blue; text-decoration: underline; }a:visited, span.MsoHyperlinkFollowed { color: purple; text-decoration: underline; }table.MsoNormalTable { font-size: 10pt; font-family: "Times New Roman"; }div.Section1 { page: Section1; }
</style><br />
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Introduction</b></span></div>
<div class="MsoNormal">
The objective in this lab project is to be able to identify
and describe the structure and function of tendons, ligaments, and cartilage.
We also need to be able to identify muscles and their functions. And finally
there is bone and what if consists of. This will also give us a little more
experience dissecting fresh material.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Procedure</b></span></div>
<div class="MsoNormal">
The material used for this lab:</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
Chicken leg</div>
<div class="MsoNormal">
Tray with foil covering</div>
<div class="MsoNormal">
Scissors</div>
<div class="MsoNormal">
Knife</div>
<div class="MsoNormal">
Paper towels</div>
<div class="MsoNormal">
Soap</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
Steps:</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg_50Y8f35369CO2KfHSws6_XBPpvInMIDYzUDU5JkeqNm2p-76E8XNqrop0ITDA9UfEO1iZ6C6ZUY08t14jUaUfBsukx1BqEqFEdLBkgTVc7mOYvaZJS0O5LTXbzF-BnaDliuK45IFDxSv/s1600/cuttingskin.jpg+.jpg" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="150" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg_50Y8f35369CO2KfHSws6_XBPpvInMIDYzUDU5JkeqNm2p-76E8XNqrop0ITDA9UfEO1iZ6C6ZUY08t14jUaUfBsukx1BqEqFEdLBkgTVc7mOYvaZJS0O5LTXbzF-BnaDliuK45IFDxSv/s200/cuttingskin.jpg+.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">cutting skin</td></tr>
</tbody></table>
<br />I covered a tray with tinfoil, so that I could just pick up
the foil to throw away contents later. Then I laid out all the other
instruments I would need. I washed
the chicken leg with soap and dried with a paper towel. I examined the outside
of the leg first – then carefully cut the skin off, noting the connective
tissue underneath. I observed the fat tissue on the outside of the skin. There
were bundles of pink muscle underneath the skin. I then probed and found a
tendon (shiny, white tissue). Next, I removed a single muscle, cutting away the
tendons and prying it from the <br />
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;">
<tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhspRYUoW8AmR3ikzcryC6a_1hVb1l6i64HlQ56_puF4mPf7MmDDf0aHpa518bJkZNa0x3BY-hb4VMHCDrpuZ88DvR43dfVhBaFr0cKF0yCpSkHTHhYynGw19fVHRmySBhxpMftl7r3T-O6/s1600/skinoff2.jpg" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="150" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhspRYUoW8AmR3ikzcryC6a_1hVb1l6i64HlQ56_puF4mPf7MmDDf0aHpa518bJkZNa0x3BY-hb4VMHCDrpuZ88DvR43dfVhBaFr0cKF0yCpSkHTHhYynGw19fVHRmySBhxpMftl7r3T-O6/s200/skinoff2.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">all skin is off<br />
</td></tr>
</tbody>
</table>
bone. Then I proceeded to remove all muscle
tissue, exposing the rest of the bone. Next, I operate the leg joint, noting
the movement. Then I cut the ligaments at the joint to observe how the bones
fit together. Then I observed the interior of the bone (I accidentally bought
just the leg without the thighs – so my bone interior was actually exposed).
Once done, I threw everything away and washed knife, scissors, and hands thoroughly.<br />
</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi5dRJopHEyxrNM9efNY26wjwBxElmgtAYwLpvjvVy-c2GsH-cKF3ijY5fmc5LyyfpV3tPn4l9Wzo2xDiBzzsmdeSSE8DWhyphenhyphenJKVyzrOAZltQFOoDkyMDr6XrIig-dsE6HQIZCu5hxHhk53p/s1600/onemusclesep.jpg" imageanchor="1" style="margin-left: auto; margin-right: auto;"><img border="0" height="150" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi5dRJopHEyxrNM9efNY26wjwBxElmgtAYwLpvjvVy-c2GsH-cKF3ijY5fmc5LyyfpV3tPn4l9Wzo2xDiBzzsmdeSSE8DWhyphenhyphenJKVyzrOAZltQFOoDkyMDr6XrIig-dsE6HQIZCu5hxHhk53p/s200/onemusclesep.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">one muscle separated</td></tr>
</tbody></table>
<br />
<br />
<br />
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgXSsoojei641haFmm0RIytbovTop7_MkjcqcdnFvmpmV7-yN_7KDWflCv27BQpJzCjekYVeslxY0RUL0drY3B-n3QIL-MCbZo9OTaClWkLgS-einMgBCPh2_E_pakGOYhWqz_9EtJHeMdW/s1600/tothebone.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="150" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgXSsoojei641haFmm0RIytbovTop7_MkjcqcdnFvmpmV7-yN_7KDWflCv27BQpJzCjekYVeslxY0RUL0drY3B-n3QIL-MCbZo9OTaClWkLgS-einMgBCPh2_E_pakGOYhWqz_9EtJHeMdW/s200/tothebone.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">cut to the bone</td></tr>
</tbody></table>
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<table align="center" cellpadding="0" cellspacing="0" class="tr-caption-container" style="margin-left: auto; margin-right: auto; text-align: center;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgQnPqhly3SJL3SSOfRbhzY4WVGTkejq39-RNgJYrpwLgsmcVXU6DW03pR5rQf1FioOpBgcZWRECoQBdxLRplj3QT6SDL9lD9ywbSf4HjNNr0apasrJlED6hhSHVzIdt2BqTH-q6fN5UchC/s1600/allmuscleoff.jpg" imageanchor="1" style="margin-left: auto; margin-right: auto;"><img border="0" height="150" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgQnPqhly3SJL3SSOfRbhzY4WVGTkejq39-RNgJYrpwLgsmcVXU6DW03pR5rQf1FioOpBgcZWRECoQBdxLRplj3QT6SDL9lD9ywbSf4HjNNr0apasrJlED6hhSHVzIdt2BqTH-q6fN5UchC/s200/allmuscleoff.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">all muscle off</td></tr>
</tbody></table>
<span style="font-size: 14pt;"><b> Results</b></span></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<div class="separator" style="clear: both; text-align: center;">
</div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgQDlLujQXWDsescT7NgJ7efTkN2gJTsWlFZK6KV1nB9nsOoNDWj9RCRPklSev0ufa9Lx3dwWk7Gp1TJsBka14J7roeWwpPQsBi16l8Jqxk-zC0kzRx3P0Eb-dQBxMVws6nX9thStL4xZpZ/s1600/skinoff.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="150" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgQDlLujQXWDsescT7NgJ7efTkN2gJTsWlFZK6KV1nB9nsOoNDWj9RCRPklSev0ufa9Lx3dwWk7Gp1TJsBka14J7roeWwpPQsBi16l8Jqxk-zC0kzRx3P0Eb-dQBxMVws6nX9thStL4xZpZ/s200/skinoff.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">connective tissue just below the skin</td></tr>
</tbody></table>
The loose, connective tissue under the skin was clear and
elastic. It is made of fibroblasts and a matrix with elastin and collagen
fibers. The fat in the skin was lumpy, gelatinous and somewhat yellow. Two of
the functions of fat include providing energy (which is its main function), and
storing energy. By supplying energy, fat allows protein to be used for
repairing and building tissue, rather than supply energy. We also eat more than what we need to
use at the current moment, so fat stores the rest. These fat cells are called
adipocytes, sometimes just referred to as adipose.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
There were several muscles present in the leg. You could see
some distinction as well as tendons that were holding them together. Where I
noticed this the most was under the joint. You could definitely see some
distinction between these muscles and the connective tissue holding them
together. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi8s5V29rzLWY940FsmISn_s1jsjZrjIrpk3Di1bdfOdCl4BtJ6Cnp_uQmSnFJdSZ3m14KDEyBSvBuz3mHvexxG6Fpw9ZpkOWQVImS09Z6c05e018sn1JA_nUcM-Mi6dZ8Lq-ekAcPz_-8V/s1600/tendon.jpg" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="150" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi8s5V29rzLWY940FsmISn_s1jsjZrjIrpk3Di1bdfOdCl4BtJ6Cnp_uQmSnFJdSZ3m14KDEyBSvBuz3mHvexxG6Fpw9ZpkOWQVImS09Z6c05e018sn1JA_nUcM-Mi6dZ8Lq-ekAcPz_-8V/s200/tendon.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">tendon</td></tr>
</tbody></table>
The tendons were white and shiny and at the ends of the
muscle. They were rather tough, fibrous bands of connective tissue. They felt
almost like bone, they were that hard. There was just a little bit of give to
them. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
Skeletal muscles are striated muscles that are arranged in
bundles called fascicles. Theses fascicles are enclosed in a sheath called a
fascia. And each fascicle contains anywhere from a few dozen to thousands of
muscle fibers, or cells. Muscles cells have more than one nucleus and they are
located just underneath the cell membrane because most of the interior of the
cell is packed with myofibrils (long, cylindrical structures arranged
parallel). And the myofibrils contain proteins called actin and myosin. (It is
the interaction of these two proteins that allow muscle contraction). Besides
being able to contract, allowing us to move, muscles resist movement, and they
also generate heat. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiQwdUREA6XUR29mVyiGNuLtp0V8wM23PedCKalE1VKunLEDYoZrBAChd6di7tWtIpV2-rAY2vYKrtTJxe3YTEi4L__6lV0G4OIIpbvO-rKR3Njwzd-0ZWn2xA9mGYrOZCUvDNfLNAkxI7P/s1600/hingemovem.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="240" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiQwdUREA6XUR29mVyiGNuLtp0V8wM23PedCKalE1VKunLEDYoZrBAChd6di7tWtIpV2-rAY2vYKrtTJxe3YTEi4L__6lV0G4OIIpbvO-rKR3Njwzd-0ZWn2xA9mGYrOZCUvDNfLNAkxI7P/s320/hingemovem.jpg" width="320" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">showing the hinge movement of the synovial joint</td></tr>
</tbody></table>
You will notice from the picture that the joint moves like a
hinge, with flexion and extension movements. After cutting away the ligaments,
(smooth and thick, and hold bone to bone) we can observe how the bones fit
together. They are connected via hyaline cartilage at this synovial, hinge
joint. When the cartilage wears away, there is too much friction. This causes
pain, inflammation, loss of movement, and disability in humans. It also places
more stress on the bones, which can cause bone spurs. (Currently, there are a
couple of surgeries to try and correct this.) The synovial joint does have an
added protection against this occurring, however. Besides the hyaline
cartilage, inside of the synovial membrane, a fluid is secreted in the interior
cavity that also helps to reduce friction. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiUNUfA6YB9Vp98nrb4U5PYp9QXyazhbA68hG-XLy_H6A6B9p7Ykx9SBfikKMuIgzkuWS59T2ghLN_kCexMWNg8VhSqrxj97yzFMLbWn-1uRCKF2b21P_YUn2o2L23PEJoaLkDa66FF9Sqi/s1600/insidebone.jpg" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="240" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiUNUfA6YB9Vp98nrb4U5PYp9QXyazhbA68hG-XLy_H6A6B9p7Ykx9SBfikKMuIgzkuWS59T2ghLN_kCexMWNg8VhSqrxj97yzFMLbWn-1uRCKF2b21P_YUn2o2L23PEJoaLkDa66FF9Sqi/s320/insidebone.jpg" width="320" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">inside the bone</td></tr>
</tbody></table>
Last, but not least, we see the inside of the bone. This
bone is spongy bone, which is made from trabeculae. Trabecula is made of
calcium and living cells. The spaces between the trabeculae are filled with red
bone marrow. Within red bone marrow are stem cells that are responsible for RBC
production, WBC or leukocyte production, and platelet production. To break this
down even further, stem cells create:</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
Erythroblasts -
this translates to RBC’s</div>
<div class="MsoNormal">
Myeloblasts – this translates to Neutrophils, Eosinophils,
and Basophils (granular leukocytes)</div>
<div class="MsoNormal">
Monoblasts – translates to monocytes (agranular leukocyte)</div>
<div class="MsoNormal">
Lymphoblasts -
translates to lymphocytes (agranular leukocyte)</div>
<div class="MsoNormal">
Megakaryoblasts – translates to platelets </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Conclusion</b></span></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
In summary, I have demonstrated some of the components of
the muscular system. And explained some of their function. It was interesting
to see the texture and feel of a tendon. Maybe this explains why you can have
tendonitis and it can feel like you have broken a bone, but you haven’t. You
have an inflamed tendon instead. This lab helped to give me a better
understanding of how it all works. Especially the stem cells and what they
produce. </div>
<div class="MsoNormal">
</div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Sources:</b></span></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
Human Biology: Concepts and Current Issues, 6<sup>th</sup> edition,
Johnson</div>
<div class="MsoNormal">
<a href="http://www.preservearticles.com/">www.preservearticles.com</a></div>
<div class="MsoNormal">
<a href="http://www.beltina.org/">www.beltina.org</a></div>
<div class="MsoNormal">
<a href="http://www.books.google.com/">www.books.google.com</a>
(Biology: The Unity and Diversity
of Life, 12th edition, Starr, Taggart, Evers, Starr</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<a href="http://www.ag.ansc.purdue.edu/">www.ag.ansc.purdue.edu</a></div>
<div class="MsoNormal">
<a href="http://www.osteoarthritis_about.com/">www.osteoarthritis_about.com</a></div>
<div class="MsoNormal">
<a href="http://www.lpch.org/">www.lpch.org</a></div>
<div class="MsoNormal">
<br /></div>Vickihttp://www.blogger.com/profile/06412364992060613157noreply@blogger.com0tag:blogger.com,1999:blog-7781582437417706765.post-30979863532701269482012-04-11T20:22:00.000-07:002012-04-11T20:46:39.668-07:00Human Biology: Unit 3 Compilation<style>
@font-face {
font-family: "Times New Roman";
}p.MsoNormal, li.MsoNormal, div.MsoNormal { margin: 0in 0in 0.0001pt; font-size: 12pt; font-family: "Times New Roman"; }table.MsoNormalTable { font-size: 10pt; font-family: "Times New Roman"; }div.Section1 { page: Section1; }
</style>
<br />
<div class="MsoNormal">
<span style="font-size: 16pt;"><b>Table of Contents</b></span></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Chapter 5: The Skeletal
System</b></span></div>
<div class="MsoNormal">
<b></b></div>
<div class="MsoNormal">
<b>5.1 – The Skeletal System consists of Connective Tissue</b></div>
<div class="MsoNormal">
<b>5.3 – Mature Bone undergoes Remodeling and Repair</b></div>
<div class="MsoNormal">
<b>5.4 – The Skeleton Protects, Supports, and Permits
Movement</b></div>
<div class="MsoNormal">
<b>5.5 – Joints form Connections between Bones</b></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Chapter 6: The Muscular
System</b></span></div>
<div class="MsoNormal">
<b></b></div>
<div class="MsoNormal">
<b>6.1 – Muscles Produce Movement or Generate Tension</b></div>
<div class="MsoNormal">
<b>6.2 – Individual Muscle Cells Contract and Relax</b></div>
<div class="MsoNormal">
<b>6.4 – Cardiac and Smooth Muscles have Special Features</b></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Chapter 7: Blood</b></span></div>
<div class="MsoNormal">
<b></b></div>
<div class="MsoNormal">
<b>7.1 – The Components and Functions of Blood</b></div>
<div class="MsoNormal">
<b>7.2 – Hemostasis: Stopping Blood Loss</b></div>
<div class="MsoNormal">
<b>7.3 – Human Blood Types</b></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Chapter 8: Heart and Blood
Vessels</b></span></div>
<div class="MsoNormal">
<b></b></div>
<div class="MsoNormal">
<b>8.1 – Blood Vessels Transport Blood</b></div>
<div class="MsoNormal">
<b>8.2 – The Heart Pumps Blood through the Vessels</b></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Chapter 9: The Immune
System and Mechanisms of Defense</b></span></div>
<div class="MsoNormal">
<b></b></div>
<div class="MsoNormal">
<b>9.1 – Pathogens cause Disease</b></div>
<div class="MsoNormal">
<b>9.2 – The Lymphatic System Defends the Body</b></div>
<div class="MsoNormal">
<b>9.3 – Keeping Pathogens Out: The First Line of Defense</b></div>
<div class="MsoNormal">
<b>9.4 – Nonspecific Defenses: The Second Line of Defense</b></div>
<div class="MsoNormal">
<b>9.5 – Specific Defense Mechanisms: The Third Line of
Defense</b></div>
<div class="MsoNormal">
<b>9.6 – Immune Memory Creates Immunity</b></div>
<div class="MsoNormal">
<b>9.7 – Medical Assistance in the War Against Pathogens</b></div>
<div class="MsoNormal">
<b>9.9 – Inappropriate Immune System Activity Causes
Problems</b></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Chapter 10: The
Respiratory System: Exchange of Gases</b></span></div>
<div class="MsoNormal">
<b></b></div>
<div class="MsoNormal">
<b>10.1 – Respiration takes Place Throughout the Body</b></div>
<div class="MsoNormal">
<b>10.2 – The Respiratory System Consists of Upper and Lower
Respiratory Tracts</b></div>
<div class="MsoNormal">
<b>10.3 – The Process of Breathing Involves a Pressure
Gradient</b></div>
<div class="MsoNormal">
<b>10.4 – Gas Exchange and Transport Occur Passively</b></div>
<div class="MsoNormal">
<b>10.5 – The Nervous System Regulates Breathing</b></div>
<div class="MsoNormal">
<b>10.6 – Disorders of the Respiratory System</b></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<style>
@font-face {
font-family: "Times New Roman";
}@font-face {
font-family: "Courier New";
}@font-face {
font-family: "Wingdings";
}p.MsoNormal, li.MsoNormal, div.MsoNormal { margin: 0in 0in 0.0001pt; font-size: 12pt; font-family: "Times New Roman"; }table.MsoNormalTable { font-size: 10pt; font-family: "Times New Roman"; }div.Section1 { page: Section1; }ol { margin-bottom: 0in; }ul { margin-bottom: 0in; }
</style>
</div>
<div class="MsoNormal">
<span style="font-size: 16pt;"><b>The Skeletal System</b></span></div>
<div class="MsoNormal">
</div>
<div class="MsoNormal">
The human body is an amazing thing. We can climb to the
tallest mountain, throw a football across an enormous field, and thread a
needle. Each action, individually, might not seem like much, but when you
consider that we are capable of all of them, the human body is remarkable. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>The Skeletal System
Consists of Connective Tissue </b></span></div>
<div class="MsoNormal">
The skeletal system consists of these three connective
tissues: </div>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal">Bones
- These are the hard elements of the skeleton that most people are
familiar with.</li>
<li class="MsoNormal">Ligaments
– Consists of dense, fibrous connective tissue that bind the bones
together.</li>
<li class="MsoNormal">Cartilage
– A specialized connective tissue, made of collagen fibers and ground
substance (an elastic gel-like fluid). Cartilage has several functions,
among them are reducing friction in joints.</li>
</ul>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Bones are the hard elements of the skeleton</b></div>
<div class="MsoNormal">
Bone is really a living tissue, although it is mainly made
of nonliving extracellular crystals of calcium minerals. It contains several
types of living cells, as well as nerves and blood vessels. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
Bone has five different functions. Some are more familiar
than others. They support our ability to sit and stand. They protect organs
such as the spleen, liver and lungs. And the attachment of bone to muscle
allows for movement. Cells in certain bones are the only source of new red and
white blood cells and platelets for blood. Without this function, the human
body would expire within months. And bones also store two minerals, calcium and
phosphate. </div>
<div class="MsoNormal">
<br /></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjL4aW_RfpuPnNGMkmPipZGTbXk7loWtDH85SeSWgawooqCsqLOeB8ul0ZirAmjmW9xF10eW0oryj6yOIEFxFSc6zTJlwslNFGTT7HO4r04WBGWj42Ou6dpuFbClTsVrdq3nxr5vmS2kb00/s1600/haversiancanal.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="256" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjL4aW_RfpuPnNGMkmPipZGTbXk7loWtDH85SeSWgawooqCsqLOeB8ul0ZirAmjmW9xF10eW0oryj6yOIEFxFSc6zTJlwslNFGTT7HO4r04WBGWj42Ou6dpuFbClTsVrdq3nxr5vmS2kb00/s320/haversiancanal.jpg" width="320" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Haversian Canal/newscenter.lbl.gov/accessed 4/11/12</td></tr>
</tbody></table>
<div class="MsoNormal">
<b>Bone contains living cells </b></div>
<div class="MsoNormal">
Compact bones are made of calcium phosphate enclosing and
surrounding living cells called osteocytes. The osteocytes are arranged in
rings in a cylindrical structure called an osteon or Haversian system. The
osteocytes nearest the center of an osteon receive nutrients via diffusion from
blood vessels that pass through the Haversian cannal. The osteocytes remain in
contact with one another via thin canals or canaliculi. They exchange nutrients
via the gap junction, so that all osteocytes are supplied with nutrients. And
waste product from the osteocytes is removed in the opposite direction by blood vessels. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
In spongy bone, which is less dense than compact bone,
osteocytes do not need a central canal. The trabecular structure gives each
osteocyte access to blood vessels in red bone marrow.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Ligaments hold bones together</b></div>
<div class="MsoNormal">
Ligaments hold bone to bone. They are an array of packed
collagen fibers, all facing the same direction, with a few fibroblasts in
between. (Fibroblasts are cells that produce and secrete the proteins that make
up collagen, elastic and reticular fibers). They give strength to certain joints
while still allowing movement of the bones in relation to one another.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Cartilage lends support</b></div>
<div class="MsoNormal">
Cartilage is smoother and more flexible than bone. You find
it where support is needed when pressure is exerted and where some movement is
necessary. There are three types of cartilage.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
Fibrocartilage – consisting of thick bundles of collagen
fibers. It withstands pressure and tension. It is found in intervertebral discs
between vertebrae and knee joints.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
Hyaline cartilage – is smooth and glass-like, thin collagen
fibers. They form embryonic structures that become bone later as well as
covering mature bones at the joint, creating a low-friction surface.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
Elastic cartilage – are elastin fibers, which are very
flexible. They help structure in the outer ear and epiglottis. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Mature Bone Undergoes
Remodeling and Repair</b></span></div>
<div class="MsoNormal">
Even though the bones stop growing longer, bone tissues
still undergo constant replacement, repair and remodeling. This is due in part
to osteoclast bone cells. There are three more cells that help facilitate bone
development – chondroblasts, osteoblasts, and osteocytes. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Bones can change in shape, size, and strength </b></div>
<div class="MsoNormal">
The remodeling of a bone happens at a compression site,
where stress is a constant, for instance, jogging or weight bearing exercise.
The constant force causes electrical currents in the bone, which stimulates
osteoblasts. So new bone is formed in regions of high compressive stress and
bone is reabsorbed in areas of low compressive stress. Trained athletes tend to
have an increase in bone mass and strength. Homeostasis of bone structure
depends on the balance of osteoclasts and osteoblasts. Osteoporosis happens
when these two cells are out of balance, which happens over time.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Bone cells are regulated by hormones </b></div>
<div class="MsoNormal">
To maintain calcium homeostasis, the rate of activity in
osteoblasts and osteoclasts are regulated by hormones in adults. If calcium
falls below a certain point, PTH, or parathyroid hormone, stimulates the
osteoclasts to secrete more bone-dissolving enzymes. This releases calcium and
phosphate into the bloodstream. If calcium levels rise, then calcitonin,
another hormone, stimulates osteoblasts, causing calcium and phosphate to be
removed from blood, back to bone.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Bones undergo repair <a href="http://www.youtube.com/watch?v=apcpNNhRu9I&feature=related" target="_blank">Bone Remodeling Video</a></b></div>
<div class="separator" style="clear: both; text-align: center;">
</div>
<div class="MsoNormal">
When you break or fracture a bone, blood vessels bleed into
that bone producing a hematoma., usually accompanied by pain and swelling.
Within days, the repair process begins as fibroblasts enter the area. Some of
these cells actually become chondroblasts and together they begin to produce a
callus (a tough fibrocartilage) between the two broken ends. Then osteoclasts
arrive and start to move dead fragments of the original bone and blood cells of
the hematoma. Osteoblasts come next and deposit osteoid matrix (a mixture of
proteins), which encourages crystallization of calcium phosphate minerals,
turning the callus into bone. Over time, this bone becomes thick and hard
again. It is very rare for a bone to break in the same place twice, because
repaired bone is usually thicker than normal.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>The Skeleton Protects,
Supports, and Permits Movement</b></span></div>
<div class="MsoNormal">
The skeleton consists of 206 bones and various connective
tissue. The bones are classified into four types: long (including limbs and
fingers), short (wrist bones), flat (including cranial, sternum, and ribs), and
irregular (hip or coxal and vertebrae, for example). There are three important
functions of the skeleton, It is a structural framework for support of soft
organs. It protects some organs from injury. And third, it allows movement and flexibility
due to the way they are joined. Further, the skeleton is organized into the
axial and appendicular skeleton.</div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEirW-h2QlgqNHYTzlMk1JcKa6-c_kYpJBMFyH64cKcMUjFxIRcJT7rprKHImSeAHbWprC8QVK-9jj8oCioFIPXr2FaxQUHqrirjtJsGgJikFWDpAziXX2AKSXSww2DA2prGXMMF3RbYSnb8/s1600/Skull_bones.jpg" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="150" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEirW-h2QlgqNHYTzlMk1JcKa6-c_kYpJBMFyH64cKcMUjFxIRcJT7rprKHImSeAHbWprC8QVK-9jj8oCioFIPXr2FaxQUHqrirjtJsGgJikFWDpAziXX2AKSXSww2DA2prGXMMF3RbYSnb8/s200/Skull_bones.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Axial Bones/wikipedia.org/accessed 4/11/12</td></tr>
</tbody></table>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>The axial skeleton forms the midline of the body</b></div>
<div class="MsoNormal">
The axial skeleton consists of the skull or cranium and
includes the mandible and maxilla, sternum, ribs, and vertebral column,
(including the sacrum). </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
The cranium consists of over two dozen flat bones that
protect the brain and form the structure of the face. </div>
<div class="MsoNormal">
<br /></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjKcvL5OMciDd5DsFXDsCXQS21eGl6mrWWnYCU8RsG4kWP6WeIR28VtKzMrWUrI_mhunJuBQ-X5L37-3qh8G6UQAoy_c0xjgA4fgJpcXKAufGeXSllqyERVLeLXjERKVLpqt5TlFRZohCab/s1600/vertebral_column.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="640" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjKcvL5OMciDd5DsFXDsCXQS21eGl6mrWWnYCU8RsG4kWP6WeIR28VtKzMrWUrI_mhunJuBQ-X5L37-3qh8G6UQAoy_c0xjgA4fgJpcXKAufGeXSllqyERVLeLXjERKVLpqt5TlFRZohCab/s640/vertebral_column.jpg" width="411" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Vertebral Column/academic.kellogg.edu/accessed 4/11/12</td></tr>
</tbody></table>
<div class="MsoNormal">
The vertebral column is the body’s main axis and consists of
the backbone and spine. It supports the head, protects the spinal cord, and is
the site of attachment for our four limbs and various muscles. This column has
33 irregular bones called vertebrae that extend from the skull to the pelvis.
The vertebral column is broken down into five regions: cervical (7 vertebrae),
thoracic (12 vertebrae), lumbar (5 vertebrae), sacral (5 fused vertebrae), and
coccygeal (4 fused vertebrae). (Insert pic with labels here) </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
The ribs and sternum protect the chest cavity. There are 12
ribs in all. One end branches from the vertebral column. The upper seven pairs
attach to the sternum via cartilage. Ribs 8-10 are indirectly joined to the
sternum via the seventh rib by cartilage. And ribs 11 and 12 are floating ribs,
meaning they do not attach to the sternum. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
The ribcage is made of the ribs, sternum and vertebral
column and forms a protective barrier around the heart, lungs, and other organs
of the thoracic cavity. Muscles between the ribs lift slightly when we breathe,
expanding the cavity and inflating the lungs. And the base of the sternum is
attached to the diaphragm, which is critical to breathing. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>The appendicular skeleton: Pectoral girdle, pelvic
girdle, and limbs</b></div>
<div class="MsoNormal">
The appendicular skeleton consists of the arms, legs, and
the pectoral and pelvic girdles.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
The pectoral girdle helps with flexibility with the upper
limbs. It is a supportive frame and consists of the left and right clavicles
and the left and right scapulas. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
There are 30 bones that make up the arms and hands. The
humerus is the long bone of the arm and attaches at one end to the scapula and
the other to ulna and radius (your forearm). The other end of the ulna and
radius attach at the carpal bones, which are made up of eight small bones of
the wrist. Then there are five metacarpals that form the palm of the hand and
14 phalanges, which are your thumb and fingers. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
All of this allows for a great range of motion, but at times
we do pay a price for this. The flexibility is also somewhat unstable, and if
you fall, this makes it easy to dislocate or break a bone. And overuse can also cause problems
with inflammation and swelling. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
The pelvic girdle consists of two coxal, or hip, bones, the
sacrum, and coccyx of the vertebral column. The coxal bones attach to the
sacral area of the vertebral column in the back. They curve towards the front
and are joined by cartilage. This forms the pelvis. Its primary function is to
support the weight of the upper body against gravity. It also protects organs
inside the pelvic cavity and is the site of attachment for the legs. </div>
<div class="MsoNormal">
<br /></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjB_3wnFSWsTy76AfSl7GHneYjA_ur7xPhglDJwkd01di775INw33KGdGSqQ5wogocIOZLoKISk6jrt-AwgDOhkdo5owK2t3kB2bG8MHsjVNwiJB4B24G7Auykz-EQ0wjSI92GEXu_AU0XK/s1600/pelvic.jpg" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="200" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjB_3wnFSWsTy76AfSl7GHneYjA_ur7xPhglDJwkd01di775INw33KGdGSqQ5wogocIOZLoKISk6jrt-AwgDOhkdo5owK2t3kB2bG8MHsjVNwiJB4B24G7Auykz-EQ0wjSI92GEXu_AU0XK/s200/pelvic.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Pelvic girdle/skillbuilders.patientsites.com/accessed 4/11/12</td></tr>
</tbody></table>
<div class="MsoNormal">
The pelvic girdle is broader and shallower and the pelvic
opening is wider in women than men. This is to allow childbirth. During
puberty, the sex hormones trigger the process of bone remodeling that shapes
the pelvic girdle and prepares it for pregnancy and birth.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
The femur, or thighbone, is the longest and strongest bone
in the body. It attaches to the coxal at one end and the knee joint, at the
other. It intersects with the tibia and fibula of the lower leg at the knee
joint also. The patella, or kneecap, protects the knee joint and provides
stability. At the other end of the tibia and fibula, they join at the ankle
with seven tarsal bones, making up the ankle and heel. There are five
metatarsals that form the foot and 14 phalanges that form the toes, similar to
the fingers.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Joints Form Connections
between Bones</b></span></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEirQEPS64VUgvl_HzaEZ0u-KQkkOWhlj7BRKkayI7zfuAICjjRYfjzrOV0TELuVwTxNF-8MqM70JysaETipaSkzHXdEHtD0pvxBLJd0lKAb3v-v3df8DwXGKlTIdKRqBzGukjCYvKQR9o4R/s1600/Joints.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="208" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEirQEPS64VUgvl_HzaEZ0u-KQkkOWhlj7BRKkayI7zfuAICjjRYfjzrOV0TELuVwTxNF-8MqM70JysaETipaSkzHXdEHtD0pvxBLJd0lKAb3v-v3df8DwXGKlTIdKRqBzGukjCYvKQR9o4R/s320/Joints.jpg" width="320" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Joints/jointsjoints.com/accessed 4/11/12</td></tr>
</tbody></table>
<div class="MsoNormal">
The structures that hold the skeleton together are joints,
ligaments and tendons. The joints or articulations, are the points of contact
between bones. Ligaments and tendons are made of connective tissue and they
help to stabilize these joints.</div>
<div class="MsoNormal">
<b> </b></div>
<div class="MsoNormal">
<b>Joints vary from immovable to freely movable</b></div>
<div class="MsoNormal">
Joints can vary from totally immovable to being able to move
freely. The following are three types: fibrous, cartilaginous, and synovial.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
Fibrous joint – are immovable. They protect the brain and
skull at birth. If you have ever seen a “soft spot” on a babies head, this is
the fibrous connective tissue, or fontanels between the flat bones of the
skull. This allows for brain development and growth and eventually these harden
and become sutures between skull bones.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
Cartilaginous joints – are hyaline cartilage and slightly
movable allowing a small amount of flexibility. These include joints that
connect vertebrae in the backbone and attachments between the lower ribs to the
sternum.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
Synovial joints – are freely movable and filled with a fluid
cavity. They are joined together and supported by ligaments. The interior is
lined with a synovial membrane which secretes fluid to lubricate the joints.
The articulating joints are also covered by hyaline cartilage to reduce
friction further. There are different types of synovial joints that move in
different ways: the hinge joint, which moves like a door hinge, in one
direction and the ball-and-socket joint, which allows movement in all
directions.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Ligaments, tendons, and muscles strengthen and stabilize
joints</b></div>
<div class="MsoNormal">
Synovial joints can withstand a tremendous amount of pressure.
This is because they are held together by ligaments, as we stated above. But
then the ligaments are further stabilized by tendons, which attach bone to
muscle. The ligaments and tendons contain collagen, which makes them strong and
flexible, much like a twisted nylon rope. At certain joints, muscle
contractions also help to strengthen just at the moment of movement, when the
support is needed the most.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<style>
@font-face {
font-family: "Times New Roman";
}@font-face {
font-family: "Courier New";
}@font-face {
font-family: "Wingdings";
}p.MsoNormal, li.MsoNormal, div.MsoNormal { margin: 0in 0in 0.0001pt; font-size: 12pt; font-family: "Times New Roman"; }table.MsoNormalTable { font-size: 10pt; font-family: "Times New Roman"; }div.Section1 { page: Section1; }ol { margin-bottom: 0in; }ul { margin-bottom: 0in; }
</style>
</div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj1RB5H1M4QR3XFvgKyDdhkkep6eReHgRnK8OUr9bT0ffDB145d86-4GLLmCfEM566XzittVRETqf2gSSzxpPKbnE4Ws5pU2_by8wjvqAnJB-_503YRSK2h8w6EaGDWDo-8-JO2I8gtNGSI/s1600/muscles.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="400" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj1RB5H1M4QR3XFvgKyDdhkkep6eReHgRnK8OUr9bT0ffDB145d86-4GLLmCfEM566XzittVRETqf2gSSzxpPKbnE4Ws5pU2_by8wjvqAnJB-_503YRSK2h8w6EaGDWDo-8-JO2I8gtNGSI/s400/muscles.jpg" width="327" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Muscles/ngureco.hubpages.com/accessed 4/11/12</td></tr>
</tbody></table>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 16pt;"><b>The Muscular System</b></span></div>
<div class="MsoNormal">
We have muscle cells in every organ in our bodies that
contribute to movement. They make up almost half of our body mass. There are
three types of muscle: skeletal, cardiac and smooth. The skeletal muscles
sculpt our bodies and give us strength and mobility, the cardiac muscle pumps
blood through our bodies, and smooth muscle accomplishes several things, such
as propelling a child through the birth canal or regulate blood flow to every cell
in our bodies. Lets take a closer look…</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
</div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Muscles Produce Movement
or Generate Tension</b></span></div>
<div class="MsoNormal">
There are voluntary muscles, which we have conscious control
over and involuntary muscles, which are beyond our control, for the most part.
They both produce and resist movement. And our muscles actually produce heat,
which is crucial to our bodies homeostasis. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>The fundamental activity of muscle is contraction</b></div>
<div class="MsoNormal">
There are certain features that all three types of muscles
have in common: they respond to chemical and/or electrical signals from other
organ systems, they contract or shorten, and they relax, returning to their
original position. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Skeletal muscles cause bones to move</b></div>
<div class="MsoNormal">
We have over 600 skeletal muscles and they interact with the
skeleton, causing bones to move or not move. Most are organized in pairs or
groups. Muscle groups that work together to create a motion or movement are
synergistic muscles. Muscles that oppose one another are antagonistic muscles.
Each muscle is joined to the skeleton in a way that produces very specific
movement of one bone to another. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>A muscle is composed of many muscle cells</b></div>
<div class="MsoNormal">
A single muscle is made of a group of muscle cells with the
same origin, insertion and function. They are arranged in bundles, or fascicles
and enclosed in a sheath, or fascia. Each cell contains more then one nucleus,
just under the cell membrane. Most of the cell is occupied with myofibrils
(long, cylindrical structures arranged parallel). When myofibrils contract, the
muscle cell shortens. </div>
<div class="MsoNormal">
<br /></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjdQT4K3mLO668UlCtJzq69jOYubUR6W0qG5ZWjnpV7h7ynK-zg4ULUjQCMlLL7kaY5AryvRMyI7z9uKEsWe90pai06LOH3UIOy7aVbSeQlERRUxgjpfHi40KKOLjQhw_C73Yd_lXEnbEyo/s1600/myofibril.jpg" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="307" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjdQT4K3mLO668UlCtJzq69jOYubUR6W0qG5ZWjnpV7h7ynK-zg4ULUjQCMlLL7kaY5AryvRMyI7z9uKEsWe90pai06LOH3UIOy7aVbSeQlERRUxgjpfHi40KKOLjQhw_C73Yd_lXEnbEyo/s400/myofibril.jpg" width="400" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Myofibril/imperial.com/accessed 4/11/12</td></tr>
</tbody></table>
<div class="MsoNormal">
<b>The contractile unit is a sarcomere </b></div>
<div class="MsoNormal">
Sarcomeres are what cause contraction of the muscle cell and
the whole muscle. This is a segment of a myobril from one Z-line (a dark line
within the myobiril) to the next. One single myofibril within one muscle cell
may contain over 100.000 sarcomeres, end to end. The sarcomere consists of two
proteins, myosin and actin. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Individual Muscle Cells
Contract and Relax </b></span></div>
<div class="MsoNormal">
There are four keys to understanding what makes a skeletal
muscle cell contract and relax:</div>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal"><b>Nerves
activate skeletal muscles</b><span style="font-weight: normal;"> – Motor
neurons stimulate muscle cells to contract. They secrete a
neurotransmitter called acetylcholine, which activates a skeletal muscle. </span></li>
</ul>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal"><b>Activation
releases calcium</b><span style="font-weight: normal;"> – Inside the muscle
cell, an electrical impulse runs down what is called a T tubule to the
sarcoplasmic reticulum (membrane chambers). The arrival of the electrical
impulse causes the release of calcium ions. The calcium diffuses into the
cell cytoplasm, come into contact with the myofibrils and sets in motion a
chain of events which lead to contraction.</span></li>
</ul>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal"><b>Calcium
initiates the sliding filament mechanism</b><span style="font-weight: normal;">
– When thick and thin filaments slide past one another, the sarcomeres
shorten. This process is called sliding filament mechanism. The thin
filament consists of the protein actin. And the thick filaments are made
of the protein myosin. When a muscle is relaxed the myosin does not touch
the thin filament of actin. When they do touch, it is this act that causes
calcium to be released. So when they do not touch, calcium is inhibited,
which inhibits muscle contraction. In other words, calcium has to be
present for muscle contraction to take place.</span></li>
</ul>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal"><b>When
nerve activation ends, contraction ends</b><span style="font-weight: normal;">
– Relaxation happens when the nerve impulse ends. No nerve activity means
no more calcium being released. Any calcium released prior, is transported
back via active transport to the sarcoplasmic reticulum.</span></li>
</ul>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Muscles require energy to contract and to relax <a href="http://www.youtube.com/watch?v=kvMFdNw35L0&feature=related" target="_blank">Muscle Contraction Video</a></b></div>
<div class="MsoNormal">
Muscles use a great deal of ATP energy to contract. Myosin
acts as an enzyme when it is exposed to calcium, which splits ATP into ADP and
inorganic phosphate. This action releases the energy necessary to do the work.
Once the nerve impulse ends, energy from the ATP breakdown is used to transport
the calcium back to the sarcoplasmic reticulum allowing relaxation of the
muscles. Muscle cells store just
enough ATP for approximately 10 seconds’ worth of activity. Once this is used
up, more ATP must be produced.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Cardiac and Smooth Muscles
have Special Features</b></span></div>
<div class="MsoNormal">
Most muscle mass is made from skeletal muscle. But cardiac
and smooth muscle have very unique features that suit their function.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>How cardiac and smooth muscles are activated</b></div>
<div class="MsoNormal">
Both cardiac and smooth muscle are considered involuntary
muscles, because we do not generally have conscious control over them. They can
act on their own, without nerve stimulation. In the cardiac muscle, it is the
pacemaker cell that sets the pace for activity, with the rest of the cells
following. Due to the gaps of the intercalated discs (where muscle cells are
joined), one cell can stimulate another. Smooth muscle cells also have gaps
that allow cells to activate one another. However, both cardiac and smooth
muscle can respond to nerve activity also. Your heart rate increase when you
exercise is an example of nerve activation for the cardiac muscle.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Speed and sustainability of contraction</b></div>
<div class="MsoNormal">
As for speed, smooth muscle is very slow, cardiac muscle
moves at a moderate speed, and skeletal muscle is the fastest.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
Smooth muscle is partially contracted all of the time. Yet
it almost never fatigues because it contracts so slowly that ATP usage is less
than ATP production. Smooth muscle is key to the homeostasis of blood pressure,
maintaining the diameter of the blood vessels indefinitely.</div>
<div class="MsoNormal">
Cardiac muscle cells go through cycles of contraction and
relaxation, necessary so the muscle does not fatigue.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Arrangement of myosin and actin filaments</b></div>
<div class="MsoNormal">
Smooth muscle filaments are arranged in bundles that attach
at various angles to the cell membrane. The thick and thin filaments slide past
each other and the attachment points are pulled towards each other, so the
cells get shorter and fatter. It looks smooth because of the bundled filaments,
rather than the sarcomeres of skeletal and cardiac muscle, which look striated.</div>
<br />
<br />
<style>
@font-face {
font-family: "Times New Roman";
}@font-face {
font-family: "Courier New";
}@font-face {
font-family: "Wingdings";
}p.MsoNormal, li.MsoNormal, div.MsoNormal { margin: 0in 0in 0.0001pt; font-size: 12pt; font-family: "Times New Roman"; }table.MsoNormalTable { font-size: 10pt; font-family: "Times New Roman"; }div.Section1 { page: Section1; }ol { margin-bottom: 0in; }ul { margin-bottom: 0in; }
</style>
<br />
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgxTuTumJoJcvIFIYj0UJY5GeVE6Y96mGIHOc6ZdqpDu90QUw1gohFLxx2bH9UL3NDXxXuDhFyTJaowYsPOPZYYReEK6G0WzMkhu_z4Jv0XJCIyevgneKmzStVNitTWhU4MjqMqr5orBfS0/s1600/blooddrop.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="200" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgxTuTumJoJcvIFIYj0UJY5GeVE6Y96mGIHOc6ZdqpDu90QUw1gohFLxx2bH9UL3NDXxXuDhFyTJaowYsPOPZYYReEK6G0WzMkhu_z4Jv0XJCIyevgneKmzStVNitTWhU4MjqMqr5orBfS0/s200/blooddrop.jpg" width="141" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Blood drop/hometownstation.com/accessed 4/11/12</td></tr>
</tbody></table>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 16pt;"><b>Blood</b></span></div>
<div class="MsoNormal">
The circulatory system is the system by which cells can
maintain oxygen levels, supply nutrients, eliminate waste, and keep
concentrations of every essential molecule and atom within acceptable limits.
It consists of the heart, blood vessels, and blood, which moves through them. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>The Components and
Functions of Blood </b></span></div>
<div class="MsoNormal">
Blood is a special connective tissue, consisting of
specialized cells and fragments of cells suspended in a watery solution made of
molecules and ions. Blood has three crucial tasks:</div>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal">Transportation:
transports all substances needed everywhere within the body, including
oxygen, nutrients, hormones, and waste. </li>
</ul>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal">Regulation:
helps regulate body temperature, water volume, and pH within the body.</li>
</ul>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal">Defense:
contains defenses within the cells to help protect your body from
infections and illness and has the ability to prevent excessive blood loss
via clotting.</li>
</ul>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
On average, blood makes up about 8% of your body weight. It
is thicker, stickier, and denser than water. Bloods components fall into two
main categories: plasma (or liquid components) and formed elements (red and
white cells, and platelets). The formed elements are denser than plasma and
sink to the bottom in a rotation device, Red cells are on the very bottom and
white blood cells and platelets are just above the red cells, appearing as a
thin, grayish white layer.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Plasma consists of water and dissolved solutes</b></div>
<div class="MsoNormal">
Plasma is the transport for blood cells and platelets. It
appears pale yellow and is about 90% water. The other 10% is made of dissolved
proteins, hormones, ions, and more than 100 different molecules (including
amino acids, fats, carbohydrates, vitamins, and waste).</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Red blood cells transport oxygen and carbon dioxide <a href="http://www.youtube.com/watch?v=Lzb9PcciBsQ&feature=related" target="_blank">O2 Blood Transport Video</a></b></div>
<div class="MsoNormal">
Erythrocytes (or red blood cells) primary function is to
carry oxygen and carbon dioxide. They have an unusual shape – doughnut-like
with a flattened center. This allows flexibility, so they can fit through small
blood vessels. They have no nucleus and basically no organelles. They are
fluid-filled plasma bags, crammed with almost 300 million molecules of
hemoglobin (an oxygen-binding protein).</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Hematocrit and hemoglobin reflect oxygen-carrying
capacity</b></div>
<div class="MsoNormal">
Hematocrit is the term used for the percentage of blood that
consists of red blood cells. Hematocrit and hemoglobin levels measure the
oxygen-carrying capacity of the blood. When this falls too low or is too high,
it can be cause for concern. Low numbers might indicate anemia, and high
numbers could indicate polycythemia. Small shifts in hematocrit and hemoblogin
are normal and temporary. </div>
<div class="MsoNormal">
<br /></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgQbHeN2Wmi6OAn-5ZTFFi17jP9TMA5pFjgAQu-Hr49QEqQYfktmpoguZZujd_KnDk5cDBEfJlF_WoGc948R9Jx9ectqCS2wdMem6C0fa3mTMX0yZONVIItvd2FpmKzlGZMuKyi1-HR-L-J/s1600/StemCells.jpg" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="200" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgQbHeN2Wmi6OAn-5ZTFFi17jP9TMA5pFjgAQu-Hr49QEqQYfktmpoguZZujd_KnDk5cDBEfJlF_WoGc948R9Jx9ectqCS2wdMem6C0fa3mTMX0yZONVIItvd2FpmKzlGZMuKyi1-HR-L-J/s200/StemCells.jpg" width="197" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Adult Human Breast Stem Cell/scienceblogs.com/accessed 4/11/12</td></tr>
</tbody></table>
<div class="MsoNormal">
<b>All blood cells and platelets originate from stem cells </b></div>
<div class="MsoNormal">
Stem cells are located in the red marrow of certain bones.
They divide constantly throughout our lives, producing immature blood cells.
These develop into platelets and various types of mature red and white blood
cells……insert a chart here….</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>RBCs have a short life span</b></div>
<div class="MsoNormal">
Stem cells first produce immature red blood cells, called
erythroblasts. Within a week’s time, these become filled with hemoglobin and
develop into mature red blood cells. Mature red blood cells only live
approximately 120 days. During that time, they make nearly 3,000 round-trips a
day, through your body. Because they have such a short life-span, they produce
at a rate of more than 2 million per second just to keep the hematocrit steady.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>RBC production is regulated by a hormone</b></div>
<div class="MsoNormal">
If oxygen levels fall for any reason, the kidneys kick in
and produce a hormone called erythropoietin. Erythropoietin is transported to
the red bone marrow, which stimulates stem cells to produce more red blood
cells. Once oxygen levels have returned to a normal level, the cells cut back
on production.</div>
<div class="MsoNormal">
<br /></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi2L61pgrCEoKk_M5sju62zn3dAQJI6DalDqZS6VbK2L1Pp7pVNH0EdyNscg7DZk5PNj2liTiWAvhwowoSUjGNYaxyI5UABM7EqnLoYgF9hE0iIhgouzi8qk4wqZArmd-8jR57QobTxehzn/s1600/WhiteBloodcells.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="130" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi2L61pgrCEoKk_M5sju62zn3dAQJI6DalDqZS6VbK2L1Pp7pVNH0EdyNscg7DZk5PNj2liTiWAvhwowoSUjGNYaxyI5UABM7EqnLoYgF9hE0iIhgouzi8qk4wqZArmd-8jR57QobTxehzn/s200/WhiteBloodcells.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">White Blood Cell/wikipedia.org/accessed 4/11/12</td></tr>
</tbody></table>
<div class="MsoNormal">
<b>White blood cells defend the body</b></div>
<div class="MsoNormal">
White blood cells, or leukocytes, are larger then red blood
cells and make up approximately 1% of whole blood. There is only one WBC for
every 700 RBCs, but they play a crucial role in the bodies defense. There are
two main categories for white blood cells: granular and agranular. They have a
short life-span, some dying within a few hours to nine days.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
Granular leukocytes:</div>
<div class="MsoNormal">
</div>
<ul>
<li>Neutrophils – most abundant WBCs, the first to combat
infection. They target bacteria and some fungi. </li>
<li>Eosinophils – the first to defend against large parasites,
they surround the parasite and release digestive enzymes. They also release
chemicals to counteract severs allergic reactions. </li>
<li>Basophils – are the rarest white blood cells. They initiate
the inflammatory response of the body with histamine. </li>
</ul>
<br />
Agranular leukocytes: <a href="http://www.youtube.com/watch?v=iDYL4x1Q6uU" target="_blank">Immune Response Video</a><br />
<br />
<ul>
<li>Monocytes – the largest WBC, can leave the bloodstream and
take up residence in body tissue, becoming macrophages that eat up invaders and
dead cellular debris. They also stimulate lymphocytes to defend the body. </li>
<li>Lymphocytes – are classified further into B and T
lymphocytes. They reside in the bloodstream, tonsils, spleen, lymph nodes, and
thymus gland. B’s produce antibodies that fight against microorganisms. And T’s
destroy bacteria, viruses, and cancer cells.</li>
</ul>
<br />
<div class="MsoNormal">
<b>Platelets are essential for blood clotting</b></div>
<div class="MsoNormal">
Platelets are not living cells and only last five to nine
days. They come from megakaryocytes (large cells derived from stem cells). They
take part in the clotting process and participate in the repair process of
damaged tissue, releasing a protein that promotes growth and repair. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Hemostasis: Stopping Blood
Loss</b></span></div>
<div class="MsoNormal">
Hemostasis is the natural process of stopping the flow of
blood, or blood loss. This happens in three stages:</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Vascular spasms constrict blood vessels to reduce blood
flow</b><span style="font-weight: normal;"> – this minimizes the damage and
prepares for the later steps.</span></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Platelets stick together to seal a ruptured vessel</b><span style="font-weight: normal;"> – they swell and clump together, forming a plug.</span></div>
<div class="MsoNormal">
<br /></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi-VuyurawYVh59nccc2ZMbNU9vCKyiJkBAnS_Zaivtr4bSbbXwmrWqFehnetgD7XXMfGiHkeyxz50GwHYoUi2fLoBx9cM7p6xyv3fzbB_5sa8rCDQqHpwIJsXim7fBWeea-pBZSIjoJYM4/s1600/Bloodclotting.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="224" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi-VuyurawYVh59nccc2ZMbNU9vCKyiJkBAnS_Zaivtr4bSbbXwmrWqFehnetgD7XXMfGiHkeyxz50GwHYoUi2fLoBx9cM7p6xyv3fzbB_5sa8rCDQqHpwIJsXim7fBWeea-pBZSIjoJYM4/s320/Bloodclotting.jpg" width="320" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Blood Clotting/creationwiki.org/accessed 4/11/12</td></tr>
</tbody></table>
<div class="MsoNormal">
<b>A blood clot forms around the platelet plug</b><span style="font-weight: normal;"> – blood changes from a liquid to a gel. Chemical
reactions produce a meshwork of protein fibers. These wind around the platelet
plug and holds the platelets, blood cells and molecules against the opening.
This initial clot can form in less than a minute and reduces or stops blood
flow at the site of injury. Then the platelets contract and tighten the clot,
pulling the walls together. The entire process takes less than an hour.</span></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Human blood types</b></span></div>
<div class="MsoNormal">
For over a century, physicians have been playing with blood
transfusions (taking one persons blood directly into another persons
bloodstream). Some attempts were successful and others were not. Now we know
that the reason is due to blood type. This is based on an ABO blood group
system. Our cells have certain proteins that our immune system recognize as “self”.
Foreign cells carry a different protein and our immune system recognizes this
as “non-self”, or antigen. When an antigen comes along, it stimulates the
immune system to defend itself. And as part of this defense, it produces
another protein, or antibody. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>ABO blood typing is based on A and B antigens</b></div>
<div class="MsoNormal">
It is the interactions of antigens and antibodies that were
hugely responsible for failed blood transfusions in the past. We fall into one
of four types of blood groups: A, B, AB, or O. Type A has A antigens, type B
has B antigens, type AB has both A and B antigens, and type O has neither. We
also have circulating antibodies and the ability to make more against surface
antigens that are not our own. Type A has B antibodies, type B has A
antibodies, type O has both A and B antibodies, and type AB has neither. When
antibodies attack foreign antigens, they damage the RBCs with those antigens,
causing them to agglutinate, or clump together. If this becomes extreme, it
causes organ damage and even death. It can also cause kidney failure. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
So, when it comes to blood transfusions, if you have type A,
you can only have transfusions from A or O because neither of these have the B
antigen. If you are type B, you cannot have transfusions with anything that has
A antigens (A or AB). People with AB can generally receive transfusions from all
types, but can only donate blood to AB individuals. And if you are type O, you
can donate to all types (universal donor), but you can only receive from type
O.</div>
<div class="MsoNormal">
<br /></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgMEisdgrxsnVsYmyn8JgFZicawNHM08_Hl9FG9KwYmUqz3fChZuLKms97rqzju7ho8vWGvlw6nvKUDFRCXzXpJO0dwGW2sY2h8MG2PIJtd1502V8qxQ7nvqBL54LTS5w0ySJWvAnlbrzWU/s1600/pregmom.jpg" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="156" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgMEisdgrxsnVsYmyn8JgFZicawNHM08_Hl9FG9KwYmUqz3fChZuLKms97rqzju7ho8vWGvlw6nvKUDFRCXzXpJO0dwGW2sY2h8MG2PIJtd1502V8qxQ7nvqBL54LTS5w0ySJWvAnlbrzWU/s200/pregmom.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Pregnant Mother/ehow.com/accessed 4/11/12</td></tr>
</tbody></table>
<div class="MsoNormal">
<b>Rh blood typing is based on Rh factor </b></div>
<div class="MsoNormal">
Rh factor is another surface antigen in red blood cells,
called this because it was first discovered in rhesus monkeys. 85% of Americans
are Rh positive and 15% negative for this antigen. This antigen is a critical
factor in pregnancy. If a mother is Rh negative, which I happen to be, and a
father is Rh positive, there is a risk of the child being Rh positive. When
this occurs, usually right at childbirth, a small amount of the fetus’s blood
leaks into the mother’s bloodstream. This causes the mother to produce anti-Rh
antibodies that attack the fetus. This can result in HDN (hemolytic disease of
the newborn), which can lead to mental retardation and even death. The risk is
usually much greater for the second pregnancy. It takes days and sometimes
weeks for the mother to produce antibodies. If the leak happens at childbirth
with the first pregnancy, there is only a slight chance of exposure. It is when
the second pregnancy comes along that the risk of HDN is so high. To prevent
this an injection of anti-Rh antibodies is given to the mother at 28 weeks of
gestation and again, no later than 3 days after childbirth. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Blood typing and cross-matching ensure blood
compatibility</b></div>
<div class="MsoNormal">
Blood typing is done by adding plasma containing small
amount of anit-A and aniti-B antibodies to drops of diluted blood. If the blood
agglutinates, then it contains the antigens that match the antibodies.
Universal recipients were AB+ individuals because they can give to the other
types. And universal donors were O- because they could give to the other blood
types. However, there have been a few transfusion reactions even after blood
typing was done. Because of this, those terms are no longer used. The reaction
happens on rare occasions because there are over 100 other, less common blood
antigens in humans. Medical laboratories now generally test not only for blood
typing, but they cross-match as well to make sure you can combine blood types.
If agglutination does not occur, it is assumed that it is a good match.</div>
<br />
<style>
@font-face {
font-family: "Times New Roman";
}p.MsoNormal, li.MsoNormal, div.MsoNormal { margin: 0in 0in 0.0001pt; font-size: 12pt; font-family: "Times New Roman"; }table.MsoNormalTable { font-size: 10pt; font-family: "Times New Roman"; }div.Section1 { page: Section1; }
</style>
<br />
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiCrETHMob_aRs9hyphenhyphenccwOwJQH3JDUZSk-zWeztBgj0bu___Mr32cVGdxaG-6VKR4uzycY-XAC8v-7vowudMdphd9ndhU9elZe_4jt_jE8EhsO3TzhUqzUkHZdGOxab5t0cKGAxciSPa5f1U/s1600/heartscan.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="200" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiCrETHMob_aRs9hyphenhyphenccwOwJQH3JDUZSk-zWeztBgj0bu___Mr32cVGdxaG-6VKR4uzycY-XAC8v-7vowudMdphd9ndhU9elZe_4jt_jE8EhsO3TzhUqzUkHZdGOxab5t0cKGAxciSPa5f1U/s200/heartscan.jpg" width="153" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Heart Scan/dailymail.co.uk/accessed 4/11/12</td></tr>
</tbody></table>
<div class="MsoNormal">
<span style="font-size: 16pt;"><b>Heart and Blood Vessels</b></span></div>
<div class="MsoNormal">
The cardiovascular system consists of the heart and blood
vessels. The heart moves, or pumps, the blood through the vascular system,
which is a network of branching conduit vessels through which the blood flows.
We would not have life without it.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Blood Vessels Transport
Blood</b></span></div>
<div class="MsoNormal">
The network of blood vessels that carry blood throughout our
bodies is so extensive that if you laid it all out end to end, they would
stretch for 60,000 miles! They are classified into three types: arteries,
capillaries, and veins. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Arteries transport blood away from the heart</b></div>
<div class="MsoNormal">
Arteries are thick-walled and muscular. The larger ones
transport blood away from the heart. The further they move away from the heart,
the smaller they get. They have to be large by the heart in order to withstand
the pressure generated by the heart. They have three distinct layers:</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
The endothelium - a thin, smooth layer of squamous
epithelial cells, which promote smooth blood flow. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
The middle layer – made of smooth muscle with elastic fibers
of connective tissue. This layer is the thickest. They help to resist high
pressure from within.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
The outer layer – tough, connective tissue made mostly from
collagen. This layer anchors vessels to tissue and helps protect them from
injury.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Arterioles and precapillary sphincters regulate blood flow</b></div>
<div class="MsoNormal">
The largest artery, or aorta, is approximately 2.5
centimeters wide, while the smallest arteries, or arterioles, are 0.3
millimeters or less in width. Where the arteriole joins a capillary, there is a
smooth muscle band called a precapillary sphincter. This sphincter acts as a
gateway, controlling blood flow into capillaries. Vasoconstriction (contraction
of smooth muscle) of the arterioles and precapillary sphincter reduces their
diameter, which reduces blood flow. Vasodilation (relaxation of the smooth
muscle) does just the opposite, increasing their diameter and blood flow. There
are internal and external factors that control vasoconstriction and
vasodilation, including nerves, hormones and environmental conditions.</div>
<div class="MsoNormal">
<br /></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhbVGxc2KyUNqWHCHwzdzmiMRhiop92Ygf4s8sd0hSnQcMu3UvjDFh73DlNCiIbm1WCZhV5TjOvOxfnw7mX68LWnD9go4SbKIjLE_-Bxw_zresTOywB6gD1kX9eE8LiBBdrD97WuBKuYkp9/s1600/capillaries.jpg" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="159" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhbVGxc2KyUNqWHCHwzdzmiMRhiop92Ygf4s8sd0hSnQcMu3UvjDFh73DlNCiIbm1WCZhV5TjOvOxfnw7mX68LWnD9go4SbKIjLE_-Bxw_zresTOywB6gD1kX9eE8LiBBdrD97WuBKuYkp9/s200/capillaries.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Capillaries/fphoto.photoshelter.com/accessed 4/11/12</td></tr>
</tbody></table>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Capillaries: Where blood exchanges substances with tissue </b></div>
<div class="MsoNormal">
Arterioles connect to capillaries (the smallest blood
vessels). Capillaries are thin-walled vessels, on average only one-hundredth of
a millimeter in diameter. They have an extensive network throughout your body.
Because of the branching design and their thin, porous walls, they allow blood
to exchange oxygen, nutrients, carbon dioxide, and waste with tissue
cells. They are the only blood
vessel that can exchange materials with the interstitial fluid (the fluid that
surrounds every living cell). So basically, capillaries function as a
biological strainer, permitting selective exchange of substances. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Lymphatic system helps maintain blood volume</b></div>
<div class="MsoNormal">
Lymphatic capillaries are blind-ended vessels, branching
throughout our body tissues and are considered part of the lymphatic system.
They pick up excess plasma fluid and return it to the cardiovascular system.
They can also pick up larger objects in the interstitial fluid that are too big
to diffuse into capillaries, including lipid drops and invading organisms. The
lymphatic system plays a crucial role in maintaining blood volume and
interstitial fluid.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Veins return blood to the heart</b></div>
<div class="MsoNormal">
Blood flows back to the heart via veins and venules (small
veins). They consist of three layers, just like arteries, only not as thick.
Veins do not have near the pressure that arteries do, which is why they are
thinner. Veins are also a reservoir for blood volume for the cardiovascular
system. Almost two-thirds of the blood in your body is located in your veins. The three mechanisms that help veins
return blood to the heart are contractions of skeletal muscle, one-way valves
inside the veins, and pressure associated with breathing. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>The Heart Pumps Blood
through the Vessels <a href="http://www.youtube.com/watch?v=NF68qhyfcoM" target="_blank">How the Heart Works Video</a></b></span></div>
<div class="MsoNormal">
Your heart pumps about 75 times per minute, not including
the times of exertion or stress. Over a 70 year period, this adds up to
approximately 2.8 billion heartbeats, which is rather impressive. Under normal
circumstances, your brain controls the rate of pumping. However, the heart can
also beat on its own, without any instruction from the brain.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>The heart is mostly muscle</b></div>
<div class="MsoNormal">
The heart sits behind the sternum, or breastbone. It is
enclosed with the pericardium, a tough fibrous sac that protects it, anchors
it, and prevents it from blood overflow. The space between the pericardium and
heart is called the pericardial cavity. This cavity contains a lubricating
fluid, which reduces friction when the heart contracts. The heart consists of
three layers, just like the vessels. </div>
<div class="MsoNormal">
<br /></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhy7FTx0o-LXcu10wRMwW8HBV6yYzInSuGmyP7Q1R6_eRacU5hHjKzIoO1ZUh4eA9AlD0-nhPU4uedNUTli-n8Fi3yY3K-2HeCEw-6dbdMVmt2eJHiQ0arovxndQl5cFUoh1J8Qgox0ZEPy/s1600/layersofheart.jpg" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="217" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhy7FTx0o-LXcu10wRMwW8HBV6yYzInSuGmyP7Q1R6_eRacU5hHjKzIoO1ZUh4eA9AlD0-nhPU4uedNUTli-n8Fi3yY3K-2HeCEw-6dbdMVmt2eJHiQ0arovxndQl5cFUoh1J8Qgox0ZEPy/s400/layersofheart.jpg" width="400" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Heart Muscle Layers/vascularconcepts.com/accessed 4/11/12</td></tr>
</tbody></table>
<div class="MsoNormal">
Epicardium – thin, outermost layer. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
Myocardium – thick, middle layer.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
Endocardium – thin, innermost layer.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>The heart has four chambers and four valves</b></div>
<div class="MsoNormal">
There are two chambers on top, called the atria, and two
chambers on the bottom, called the ventricles. Then there is a muscular
partition, the septum, that separates left and right. Blood returning to the
heart from the tissues enters the right atrium and passes through a valve to
the right ventricle. Blood returning from the lungs, enters the left atrium,
then through a valve to the left ventricle. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
The four heart valves enforce the one-way flow pattern and
prevent blood from flowing backwards. The right and left atrioventricular (AV)
valves prevent blood from flowing back into the atria when the ventricles
contract. The two semilunar valves (pulmonary and aortic), prevent backflow
into the ventricles from the main arteries leaving the heart when the heart
relaxes.</div>
<div class="MsoNormal">
<br /></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhBjabHOWobmygzZ0Sgb5im-bL8ZCWvP4nDhGHjEcHxFcFCdKXc8rajve9A9jDxwqZgr3RSoLO_zTLFXoC4L7mgeOwa4axjiKnE5p3j2L1FDJdHCWedSlidsPn6xZFtN_Od6Kp366z5xwn2/s1600/PulmunaryCircuit.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="320" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhBjabHOWobmygzZ0Sgb5im-bL8ZCWvP4nDhGHjEcHxFcFCdKXc8rajve9A9jDxwqZgr3RSoLO_zTLFXoC4L7mgeOwa4axjiKnE5p3j2L1FDJdHCWedSlidsPn6xZFtN_Od6Kp366z5xwn2/s320/PulmunaryCircuit.jpg" width="289" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Pulmunary Circuit/images.vintagemedstock.com/accessed 4/11/12</td></tr>
</tbody></table>
<div class="MsoNormal">
<b>The pulmonary circuit provides for gas exchange </b></div>
<div class="MsoNormal">
The heart pumps blood through the pulmonary circuit, or
lungs, and through they systemic circuit (all cells in the body). Blood that
returns to the heart is deoxygenated, giving it all to tissue cells and taken
up by carbon dioxide. Once the
blood reaches the pulmonary capillaries, blood gives up carbon dioxide and
receives fresh oxygen from our inhalation. Deoxygenated blood on the right side
of the heart never mixes with oxygenated blood in the left. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>The systemic circuit serves the rest of the body</b></div>
<div class="MsoNormal">
Once blood enters the left ventricle, it begins the systemic
circuit, which takes it to the rest of the body. The left ventricle pumps blood
through the aortic semilunar valve into the aorta. From there, it travels
through the arteries and arterioles to the capillaries, giving oxygen and
nutrients to all the tissues and organs and removing waste. Then, fro the
capillaries, it flows to the venules, veins, and back again to the atrium. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
Because the heart is so thick and hard-working, it has its
own set of coronary arteries and its own set of cardiac veins. </div>
<br />
<br />
<style>
@font-face {
font-family: "Times New Roman";
}@font-face {
font-family: "Courier New";
}@font-face {
font-family: "Wingdings";
}p.MsoNormal, li.MsoNormal, div.MsoNormal { margin: 0in 0in 0.0001pt; font-size: 12pt; font-family: "Times New Roman"; }table.MsoNormalTable { font-size: 10pt; font-family: "Times New Roman"; }div.Section1 { page: Section1; }ol { margin-bottom: 0in; }ul { margin-bottom: 0in; }
</style>
<br />
<div class="MsoNormal">
<span style="font-size: 16pt;"><b>The Immune System and
Mechanisms of Defense</b></span></div>
<div class="MsoNormal">
The world is swarming with bacteria, a living organism too
small to see with the naked eye. We even have some nonliving entities – viruses
and prions. They are everywhere,
doorknobs, money, clothing. You name it, they live there. Some are beneficial
to us, some are harmless, and some are deathly or cause disease. We call these
pathogens. Pathogens come from outside our bodies, but we also have challenges
from within, such as mutations to our DNA’s cells. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
We have several mechanisms to help defend ourselves,
including barriers to entry or ways of expelling and neutralizing pathogens,
nonspecific defenses that help our bodies respond to tissue damage, and
specific defenses which recognize and kill specific bacteria and other foreign
cells. Our bodies have several ways in which to protect us – this is our immune
system.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Pathogens cause disease</b></span></div>
<div class="MsoNormal">
Bacteria, viruses, fungi, a few protozoa, and possibly
prions, are all considered pathogens. And even some larger parasites, such as
worms can also be pathogens, although they are rare in industrialized areas. </div>
<div class="MsoNormal">
<br /></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg8zVV34UPQ1n9LA54NXxu8NfV8TJp_RXCqjAXNPjmtT6TXLdWxUH7Bjgu2styWJ8oCvpHUvCy50kq3F7w4TWYttis7mZlxuGnUchnb7q-aUXWw3DimO0FOYxNSRtNF1694OTEHlFM8PmXb/s1600/bacteria.jpg" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="232" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg8zVV34UPQ1n9LA54NXxu8NfV8TJp_RXCqjAXNPjmtT6TXLdWxUH7Bjgu2styWJ8oCvpHUvCy50kq3F7w4TWYttis7mZlxuGnUchnb7q-aUXWw3DimO0FOYxNSRtNF1694OTEHlFM8PmXb/s320/bacteria.jpg" width="320" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">E. Coli Bacteria/microbeworld.org/accessed 4/11/12</td></tr>
</tbody></table>
<div class="MsoNormal">
<b>Bacteria: Single-celled living organisms </b></div>
<div class="MsoNormal">
If you go by the variety and numbers of bacteria living on
earth, they are one of the most successful organisms on the planet. They use
ATP as a direct source of energy and amino acids for making protein. They also
store carbohydrates and fats. And they obtain these raw materials anywhere they
can. Some bacteria breakdown raw sewage and cause decomposition of dead animals
and plants, which plays an essential role in recycling energy. Others get
nutrients from soil and air. We have learned how to harness some bacteria to
produce things like hormones, antibiotic drugs, etc… But some of the bacteria
are pathogens that rely on living human cells as their source of energy. They cause
pneumonia, tuberculosis, syphilis, Lyme disease, and a boat load of other
diseases and illnesses. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Viruses: Tiny infectious agents</b></div>
<div class="MsoNormal">
There is some debate as to whether or not viruses are a
living organism or not. They are extremely small, have no organelles, and
cannot reproduce on their own. However, once they enter a living cell, they
take over and use the cell’s organelles to make more viruses. Some of the
diseases caused by viruses are AIDS, hepatitis, encephalitis, and rabies. Some
less harmful, but annoying viruses are colds, warts and chicken pox. Not every
human reacts the same way to a virus either. For some, they can shake it off in
a matter of days, while for others, it could kill them.</div>
<div class="MsoNormal">
<br /></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhCxp5g4SDTu9fh1-TWR7yjtdPl7eY__JwzJlwJnY5W6leGMWEGY_vy5CoHtLhEynGLrZGI5W_rAkqQw_wBoAsjE7tjms5GSZawy1fjWJXHWVmx1rfl_D_KIFwcatqScITyrf5SO4hFRzcf/s1600/prion.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="150" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhCxp5g4SDTu9fh1-TWR7yjtdPl7eY__JwzJlwJnY5W6leGMWEGY_vy5CoHtLhEynGLrZGI5W_rAkqQw_wBoAsjE7tjms5GSZawy1fjWJXHWVmx1rfl_D_KIFwcatqScITyrf5SO4hFRzcf/s200/prion.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Prions/findingnew.com/accessed 4/11/12</td></tr>
</tbody></table>
<div class="MsoNormal">
<b>Prions: Infectious proteins</b></div>
<div class="MsoNormal">
You’ve heard of mad cow disease (called this because it was
first observed in cattle), right? Well, what caused it was a prion. Prions are
misfolded forms of a normal brain cell protein. And they trigger the misfolding
of other normal proteins as well. Once they enter a nerve cell, they begin to
propagate until eventually there are so many infected brain cells, that the
cells die and burst, which releases even more prions to other brain cells.
These creatures, if you will, are resistant to cooking, freezing, and drying.
There is no known cure. The infection in humans seems to come from eating
contaminated beef. Since banning the use of mammalian meat and bone meal as
cattle feed, the incidence of mad cow disease has dropped drastically. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Transmissibility, mode of transmission, and virulence
determine health risk</b></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEihyphenhyphenAYNA7rkrUj8B39fJLP_KasZ0SWXpoPj2_qbi-8RuyLkeYhrHQYAIvBkinBOlTY45Vk8WJi6ZeHxSOeS6ONsEtcyQ2JUa-q9LwcfMGv9lq-WWFUkrheTl2DZSCmOZk0TsJUSy24uQico/s1600/The+Plague.jpg" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="150" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEihyphenhyphenAYNA7rkrUj8B39fJLP_KasZ0SWXpoPj2_qbi-8RuyLkeYhrHQYAIvBkinBOlTY45Vk8WJi6ZeHxSOeS6ONsEtcyQ2JUa-q9LwcfMGv9lq-WWFUkrheTl2DZSCmOZk0TsJUSy24uQico/s200/The+Plague.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">The Plague/dweelingintheworld.wordpress.com/accessed 4/11/12</td></tr>
</tbody></table>
<div class="MsoNormal">
Some pathogens are clearly more dangerous to humans than
others. There are three factors that determine the danger – transmissibility
(how easily it passes from one person to another), mode of transmission (how it
spreads), and virulence (how damaging the resulting disease is). On occasion,
there have been diseases that were highly transmissible and highly virulent.
This caused deadly epidemics back in 1348-1350, as bubonic plague, a bacteria,
killed 25-40% of the European population. And in 1918, an influenza outbreak
that caused 20 million deaths worldwide. More recently, is the Ebola virus in
Africa in 1976. And this one is still a threat today, killing 80% of an exposed
population in less than two weeks. Pathogens are obviously continuing to be a
challenge to the human population.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>The Lymphatic System
Defends the Body</b></span></div>
<div class="MsoNormal">
The lymphatic system works closely with the cardiovascular
system. It has three important functions: </div>
<div class="MsoNormal">
<a href="http://www.youtube.com/watch?v=IntC0B830cI&feature=fvwrel" target="_blank">How the Lypmphatic System Works Video</a></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal">helps
maintain blood volume in the cardiovascular system</li>
<li class="MsoNormal">transports
fats and fat-soluble vitamins absorbed from the digestive system to the
cardiovascular system</li>
<li class="MsoNormal">defends
the body against infection.</li>
</ul>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
The basic components of the lymphatic system and functions
are listed below.</div>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal"><b>Lymphatic
vessels transport lymph</b><span style="font-weight: normal;"> – lymph is a
milky fluid containing white blood cells, proteins, fats, and the
occasional bacterium and virus. There structure allows them to take
substances too large to enter a blood capillary. They also have valves
that prevent backflow of lymph.</span></li>
<li class="MsoNormal"><b>Lymph
nodes cleanse the lymph</b><span style="font-weight: normal;"> – lymph nodes
are responsible for removing microorganisms, cellular debris, and abnormal
cells from the lymph before it returns to the cardiovascular system.</span></li>
<li class="MsoNormal"><b>The
spleen cleanses blood</b><span style="font-weight: normal;"> – the spleen
helps fight infection and controls the quality of circulating red blood
cells by removing old and damaged ones. </span></li>
<li class="MsoNormal"><b>Thymus
gland hormones cause T lymphocytes to mature</b><span style="font-weight: normal;"> – they thymus gland secretes two hormones, thymosin and
thymopoeitin. These hormones cause T cells to mature. T cells are crucial
in the bodies defense mechanisms.</span></li>
<li class="MsoNormal"><b>Tonsils
protect the throat</b><span style="font-weight: normal;"> – the tonsils and
adenoids are a mass of lymphatic tissue that help to filter out
microorganisms that enter the throat in air and food.</span></li>
</ul>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Keeping Pathogens Out: The
First Line of Defense</b></span></div>
<div class="MsoNormal">
<b>Skin: An effective deterrent</b></div>
<div class="MsoNormal">
The skin is the most important defense or barrier that we
have for pathogen entry. It has four crucial attributes that make it so
effective:</div>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal">It’s
structure – keratin, a fibrous protein, forms a tough barrier on the
surface of our skin.</li>
<li class="MsoNormal">The
fact that it is constantly being replaced. – dead cells are constantly
shed, along with any pathogens, and are replaced by new cells.</li>
<li class="MsoNormal">It’s
acidic pH – the relatively low pH of healthy skin is a detriment to many
microorganisms.</li>
<li class="MsoNormal">The
production of an antibiotic by sweat glands – the sweat glands produce an
antibiotic peptide called dermicidin that can kill a range of bacteria.</li>
</ul>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Impeding pathogen entry in areas not covered by skin</b></div>
<div class="MsoNormal">
Successful pathogens enter the body through mucous membranes
that line the digestive, urinary, respiratory and reproductive tracts. They
thrive in the moist surface having direct contact with living cells. They can
also enter through the eyes and ears. Fortunately, our body also has defenses
in these areas.</div>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal">Tears
and saliva can wash away particles, kill bacteria, rinse away harmful
microorganisms. They both contain lysozyme, and enzyme that kills
bacteria.</li>
<li class="MsoNormal">Earwax
traps small particles and microorganisms.</li>
<li class="MsoNormal">Mucus,
a thick-like gel, trap microorganisms. </li>
<li class="MsoNormal">Digestive
and vaginal acids can kill pathogens. Digestive acid is so strong, it can
kill almost every pathogen. There is only one strain of bacteria that can
thrive in this acid, helicobacter pylori. </li>
<li class="MsoNormal">Vomiting,
urination, and defecation are also effective ways to get rid of toxins or infection. </li>
<li class="MsoNormal">Resident
bacteria that live in the mucous membranes of the vaginal and digestive
tracts helps to control population levels of more harmful bacteria by
competing for food. </li>
</ul>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Nonspecific Defenses: The
Second Line of Defense</b></span></div>
<div class="MsoNormal">
We call the second line of defense nonspecific because once
pathogens get through the first line of defense, our bodies kick in without
regard to what the target is to destroy the pathogen. </div>
<div class="MsoNormal">
<br /></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiRTsbjRWk9u_MTao6EcOs5t-_jL8KO24FLQmGw57-9muhpM9DBnMis1s6yBgLVC61VLDGt_dmexbBRVz9xcGA0prDjNxx-4-PWiJ4awcq6OzYSgt9H2h-HK5aikM2tgowf1z0OaDbIKi5W/s1600/Phagocyteeatingbacteria.jpg" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="200" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiRTsbjRWk9u_MTao6EcOs5t-_jL8KO24FLQmGw57-9muhpM9DBnMis1s6yBgLVC61VLDGt_dmexbBRVz9xcGA0prDjNxx-4-PWiJ4awcq6OzYSgt9H2h-HK5aikM2tgowf1z0OaDbIKi5W/s200/Phagocyteeatingbacteria.jpg" width="191" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Phagocyte Eating Bacteria/foodmedicaleponyms.com/accessed 4/11/12</td></tr>
</tbody></table>
<div class="MsoNormal">
<b>Phagocytes engulf foreign cells </b></div>
<div class="MsoNormal">
Phagocytes are white blood cells that destroy foreign cells
through phagocytosis. Neutrophils and macrophages digest and destroy bacteria,
some fungi, viruses, and bacterial parasites. (Macrophages also serve as clean
up duty and they release chemicals that stimulate production of more white
blood cells). Eosinophils kick into action when invaders are too big to be
engulfed by phagocytosis. They bombard and digest large parasites and some
foreign proteins.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Inflammation: Redness, warmth, swelling, and pain</b></div>
<div class="MsoNormal">
The inflammatory response is triggered by any type of tissue
injury, whether infection, burns, chemicals, or physical trauma. The four
outward signs are redness, warmth, swelling, and pain. These outward symptoms,
although uncomfortable, prevent damage from spreading, dispose of cellular
debris and pathogens, and begin the process of tissue repair.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Natural killer cells target tumors and virus-infected
cells</b></div>
<div class="MsoNormal">
NK cells are lymphocytes that release a chemical that breaks
down the foreign cells membrane, creating holes. Then the nucleus disintegrates
quickly. They target tumors and cells infected by viruses. They also secrete a
substance that helps with the inflammatory response.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>The complement system assists other defense mechanisms</b></div>
<div class="MsoNormal">
The complement system consists of at least 20 plasma proteins
that circulate in the blood assisting other defense mechanisms. It works much
like a domino effect, with one protein activating another. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Interferons interfere with viral reproduction <a href="http://www.youtube.com/watch?v=3qFu6Fv4cJk" target="_blank">How Interferons Work Video</a></b></div>
<div class="MsoNormal">
When cells become infected by viruses, they release a group
of proteins called interferons. These interferons diffuse to nearby healthy
cells, bind to their membranes, and stimulate production of proteins that
intefere with the synthesis of viral proteins. This makes it much harder for
the virus to infect the protected cells. (Some interferons are being produced
in laboratories and show some promise of assisting in the fight against certain
viral diseases).</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Fever raises body temperature</b></div>
<div class="MsoNormal">
We have one final weapon, a high body temperature. Normal
range is 97-99 degrees. When macrophages detect and attack bacteria, viruses,
and other foreign substances, they release a chemical call pyrogens into the
bloodstream. This causes your brain to set your thermostat to a higher
temperature. This makes it more difficult for pathogens. It increases the
metabolic rate of body cells, which speeds up the defense mechanisms and tissue
repair.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Specific Defense
Mechanisms: The Third Line of Defense</b></span></div>
<div class="MsoNormal">
This third line of defense targets very specific pathogens
or foreign substances. It has a “memory” which is capable of storing
information from past exposures, enabling your body to respond to later
invasions more quickly. And it protects your entire body – your immunity is not
limited to the site of infection. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Your immune system targets antigens</b></div>
<div class="MsoNormal">
Your immune system responds to each unique antigen by
producing a specific antibody to attack and inactivate the antigen and the cell
carrying it. We have what are called major histocompatibility complex proteins
(MHC) that are considered self-markers. They work much like a password. If your
immune system reads the password, it leaves it alone. If there are cells that
do not have this, the immune response kicks in.</div>
<div class="MsoNormal">
<br /></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiGxoRFaU3k1wE1VYu2LguJnFflvoJIYjBVdNw8NkwEPjW8H_txAxMTVAYhUXXnycztzT2JrcQNPHBzrXRb4ROzv7csOsSjhkgHeBaK9J7z-yjlb46vbY3y2KegPzSTNXbMwxzfXXMIg5Gw/s1600/T-lymphocyte.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="244" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiGxoRFaU3k1wE1VYu2LguJnFflvoJIYjBVdNw8NkwEPjW8H_txAxMTVAYhUXXnycztzT2JrcQNPHBzrXRb4ROzv7csOsSjhkgHeBaK9J7z-yjlb46vbY3y2KegPzSTNXbMwxzfXXMIg5Gw/s320/T-lymphocyte.jpg" width="320" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">T Lymphocyte/daviddarling.info/accessed 4/11/12</td></tr>
</tbody></table>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Lymphocytes are central to specific defenses</b></div>
<div class="MsoNormal">
The two types of lymphocytes are B and T cells, getting
their names based on where they mature. B cells mature in bone marrow. They are
responsible for antibody-mediated immunity. Meaning they produce proteins that
bind with and neutralize specific antigens. This line of defense works for
viruses, bacteria, and foreign molecules.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
T cells mature in the thymus gland. They are responsible for
cell-mediated immunity. Some T cells attack foreign antigens directly, while
others release a protein that helps to coordinate the immune response.
Cell-mediated immunity helps to protect us from parasites, bacteria, viruses,
fungi, cancerous cells, and foreign cells. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>B cells: Antibody-mediated immunity</b></div>
<div class="MsoNormal">
B cells have unique surface receptors that allow them to
recognize specific antigens. They travel through the bloodstream and take up
residence in the lymph nodes, spleen and tonsils. Here they remain inactive
until they sense a foreign cell with that particular antigen. B cells multiply
after they encounter an antigen and bind to it. Most of these clone cells are
plasma cells. Plasma cells secrete antibodies into the lymph fluid and
eventually into blood plasma. Other clone cells become memory cells. These
cells store the information about the pathogen, which allows your body to
respond much quicker with future encounters.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>The five classes of antibodies</b></div>
<div class="MsoNormal">
Gamma globulins is the class of blood plasma proteins that
antibodies belong to. You will see the term immunoglobulin used frequently due
to their crucial role in immunity.</div>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal">IgG –
is 75% of immunoglobulins. These antibodies are found in blood, lymph,
intestines, and tissue fluid. They activate the compliment system and
neutralize toxins. They are the only antibody that cross the placenta
during pregnancy to pass on the mother’s acquired immunity to the fetus.</li>
</ul>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal">IgM –
is 5-10% of immunoglobulins and are the first antibody to be released
during an immune response. These are found in blood and lymph and activate
the compliment system also. They can also cause foreign cells to
agglutinate (ABO blood cell antibodies belong to this class).</li>
</ul>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal">IgA –
makes up 15%. They enter areas of the body where mucous membranes reside.
They neutralize infectious pathogens. They are also present in breast milk
and are transmitted to an infant during breast-feeding.</li>
</ul>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal">IgD –
is less than 1%. These antibodies are in blood, lymph, and B cells. There
function is not clear yet, but they may play a role in activating the B
cells. </li>
</ul>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal">IgE –
approximately 0.1%, these are the rarest immunoglobulins. They reside in B
cells, mast cells, and basophils. These activate the inflammatory response
by triggering the release of histamine. They also play a part in allergic
responses.</li>
</ul>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Antibodies’ structure enables them to bind to specific
antigens</b></div>
<div class="MsoNormal">
All antibodies share the same basic structure, having four
linked polypeptide chains arranged in a Y shape. Each of these chains has a
region that forms a trunk and two branches. There is a variable region where
the antigen binds. Each variable region has a unique shape that fits only one
antigen.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>T cells: Cell-mediated immunity <a href="http://www.youtube.com/watch?v=IntC0B830cI&feature=fvwrel" target="_blank">Immune Response Video</a></b></div>
<div class="MsoNormal">
There are several types of T cells, determined by the
surface protein they develop (CD4 or CD8). CD4 T cells will become either helper or memory cells and
CD8 T cells will become cytotoxic and suppressor cells. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Immune Memory Creates
Immunity</b></span></div>
<div class="MsoNormal">
The presence of memory cells, created from B and T cells,
are the basis for immunity from disease. Memory cells are long-lived. Some
lasting a lifetime in their ability to generate a secondary immune response.
This system is so effective, that many times you may not even realize you have
been exposed to the pathogen again. You may wonder why we have trouble with
colds and flu…this is because there are hundreds of viruses that cause this
ailment. These viruses actually adapt and change so rapidly, that they are
different almost every year.
Fortunately, we have an awesome immune system to combat this.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Medical Assistance in the
War Against Pathogens</b></span></div>
<div class="MsoNormal">
Though our bodies have an incredible defense against
pathogens, we have taken matters into our own hands by developing the science
of medicine. </div>
<div class="MsoNormal">
<br /></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhpaynx4whukOrckTMRtzmUpLVP6h4-OV0zi6fW7OG1gNPYiQ73yLUN1pmMG_PdCMSUDUWy-I-rV5W-66ziR5UgN3mD27rgS9HMloiP9pLc-I_zLRpQWgkMQbZ2zYQ_eXEIHki9bSxZ6j18/s1600/vaccine.JPG" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="186" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhpaynx4whukOrckTMRtzmUpLVP6h4-OV0zi6fW7OG1gNPYiQ73yLUN1pmMG_PdCMSUDUWy-I-rV5W-66ziR5UgN3mD27rgS9HMloiP9pLc-I_zLRpQWgkMQbZ2zYQ_eXEIHki9bSxZ6j18/s200/vaccine.JPG" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Vaccine/historyofvaccines.org/accessed 4/11/12</td></tr>
</tbody></table>
<div class="MsoNormal">
<b>Active immunization: An effective weapon against
pathogens </b></div>
<div class="MsoNormal">
The process of activating the bodies immune response in
advance, before it encounters the pathogen, is called active immunization. This
involves administering an antigen in the form of a vaccine. Some are created
from dead or weakened pathogens and others from live pathogens. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
However, there are concerns with vaccines. There are issues
with safety, time, and expense. There is the risk of the pathogen actually
causing the disease that it was supposed to prevent. Typically a vaccine only
targets one pathogen, so a different vaccine is needed for every virus. And they do not cure an existing
disease. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Passive immunization can help against existing or
anticipated infections</b></div>
<div class="MsoNormal">
Passive immunization involves giving a person antibodies
from a human or animal donor that has immunity from that illness. It is usually
given in the form of a gamma globulin shot. It can be given to someone who has
already been exposed to a pathogen. It is not as long-lasting as active
immunization though, disappearing from circulation fairly quickly. It has been
effective against some viral infections like hepatitis B and measles, bacterial
infections such as tetanus, and Rh incompatibility. Passive immunization also
happens naturally across the placenta and through breast-feeding.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Monoclonal antibodies: Laboratory-created for commercial
use</b></div>
<div class="MsoNormal">
Monoclonal antibodies are produced in a lab from cloned
descendants of a single hybrid B cell. They can be produced fairly
inexpensively and are considered somewhat pure. They are proving useful in
research and testing, as well as in cancer treatments preparations. They are
working on the possibility of delivering monoclonal antibodies directly into
cancer cells, sparing the nearby healthy tissue.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Antibiotics combat bacteria</b></div>
<div class="MsoNormal">
The first antibiotics were derived from molds and fungi, but
today are mostly synthesized by pharmaceutical companies. Some antibiotics
combat only certain types of bacteria, while others are considered
broad-spectrum, effective against several groups of bacteria. But they are not
effective against viruses.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Inappropriate Immune
System Activity Causes Problems</b></span></div>
<div class="MsoNormal">
<b>Allergies: A hypersensitive immune system</b></div>
<div class="MsoNormal">
An allergy is an inappropriate immune response to an
allergen. The allergen is not a dangerous pathogen, but the body reacts as if
it were. These reactions can be mild to severe, some even life threatening.
Exposure to an allergen causes a primary immune response…B cells produce the
IgE antibody. The antibody binds to mast cells and to circulating basophils.
Then the second exposure the mast cells and basophils to release histamine,
which results in an inflammatory response. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Autoimmune disorders: Effective recognition of “self” <a href="http://www.youtube.com/watch?v=0mz33fLJGwQ&feature=related" target="_blank">Autoimmune Diseases Video</a></b></div>
<div class="MsoNormal">
On occasion, the bodies ability to distinguish self from
non-self fails. The immune system produces antibodies and cytotoxic T cells
that target its own cells. This is an autoimmune disorder. There is currently
no cure for autoimmune disorders, which include multiple sclerosis, type I
diabetes mellitus, lupus erythematosus, and rheumatoid arthritis. </div>
<br />
<style>
@font-face {
font-family: "Times New Roman";
}@font-face {
font-family: "Courier New";
}@font-face {
font-family: "Wingdings";
}p.MsoNormal, li.MsoNormal, div.MsoNormal { margin: 0in 0in 0.0001pt; font-size: 12pt; font-family: "Times New Roman"; }table.MsoNormalTable { font-size: 10pt; font-family: "Times New Roman"; }div.Section1 { page: Section1; }ol { margin-bottom: 0in; }ul { margin-bottom: 0in; }
</style>
<br />
<div class="MsoNormal">
<span style="font-size: 16pt;"><b>The Respiratory System:
Exchange of Gases</b></span></div>
<div class="MsoNormal">
The primary function of the respiratory system is to
exchange oxygen and carbon dioxide (gases) with the air. We can survive for
days without water or nutrients, but would die within minutes if denied oxygen.
So I would say the respiratory system is pretty important. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Respiration takes place
throughout the body <a href="http://www.youtube.com/watch?v=o2OcGgJbiUk&feature=related" target="_blank">How Respiration Works Video</a></b></span></div>
<div class="MsoNormal">
Respiration involves four processes: breathing or
ventilation, external respiration, internal respiration, and cellular
respiration. Breathing is through the respiratory system and its associated bones,
muscles, and nerves. External respiration takes place within the lungs.
Internal and cellular respiration take place in the tissues throughout the
body.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>The Respiratory System
Consists of Upper and Lower Respiratory Tracts</b></span></div>
<div class="MsoNormal">
<b>The upper respiratory tract filters, warms, and
humidifies air</b></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhR25_fP199tBejBBix_zxDUXpHerswZGDZZLhfbxI24XS2zDfBr3GC18BZ15Hg1zijkKpCBr4lUA267U0wiTB-0YVZeP8lVET5eKo15wyHDTHSt8XM1fZ1YcsAB7cO3wJCDJcvyutF8j5E/s1600/respiratorysystem.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="247" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhR25_fP199tBejBBix_zxDUXpHerswZGDZZLhfbxI24XS2zDfBr3GC18BZ15Hg1zijkKpCBr4lUA267U0wiTB-0YVZeP8lVET5eKo15wyHDTHSt8XM1fZ1YcsAB7cO3wJCDJcvyutF8j5E/s320/respiratorysystem.jpg" width="320" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Respiratory System/scribd.com/accessed 4/11/12</td></tr>
</tbody></table>
<div class="MsoNormal">
The upper tract consists of the nose, nasal cavity, and
pharynx. When you inhale, air enters through your nose or mouth and then flows
into the nasal cavity. Air is filtered partially by nose hairs before entering
the cavity. The cavity is lined with epithelial tissue and blood vessels. The
blood vessels help to warm the air and the tissues secrete mucus, which
humidifies the air. Next, the air enters the pharynx or throat. From here, air
heads to the lower respiratory tract.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>The lower respiratory tract exchanges gases</b></div>
<div class="MsoNormal">
The lower respiratory tract includes:</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
The larynx -
maintains an open airway, routes food and air to appropriate channels, and
assists in the production of sound.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
The trachea - transports air down to the left and right
bronchi.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
The bronchi – and bronchioles (smaller branches), not only
transport air, but clean it, warm it to body temperature, and saturate it with
water vapor before it reaches the lungs.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
The lungs – are the organs of gas exchange. They occupy most
of the thoracic cavity. There is a left and a right lung, separated by the
heart. The gas exchange itself, takes place in the alveoli. The lungs are a
network of branching airways that end in 300 million tiny air-sacs called
alveoli. The combined surface area is nearly 800 square feet, 40 times the area
of our skin. It is this surface
area and the thinness of the epithelium that facilitate gas exchange with capillaries.
Pulmonary capillaries come into very close proximity to the air-filled alveoli.
Only two living cells separate blood from air at this point. A series of veins
and venules collects the oxygenated blood from the pulmonary capillaries and
returns the blood to the left side of the heart. From there, it is transported
to all parts of the body. (The close contact between air and blood in the lungs
is turning out to be an alternative way to administer medications).</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<a href="http://www.youtube.com/watch?v=b4wveY2-lCo&feature=related" target="_blank">Oxygen Video</a></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>The Process of Breathing
Involves a Pressure Gradient</b></span></div>
<div class="MsoNormal">
<b>Inspiration brings in air, expiration expels it</b></div>
<div class="MsoNormal">
Inspiration pulls air into the respiratory system as lung
volume expands. The diaphragm contracts
- flattening and pulling the center downward. While this is happening, the intercostal muscles contract,
pulling the ribs upward and outward. These two actions increase the volume of
the pleural cavity and lowers the pressure within the pleural space. This
expansion reduces air pressure within the lungs relative to the atmosphere,
which allows air to rush in.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
In expiration, the muscle contraction ends. As they relax,
the diaphragm returns to its domed shape, the ribs move downward and inward,
and the pleural cavity becomes smaller. The lungs become smaller, so the
pressure rises relative to the atmosphere, and air flows out.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Lung volumes and vital capacity measure lung function</b></div>
<div class="MsoNormal">
Tidal volume represents each breath of air or approximately
500 ml. (Only about 350 ml reach the alveoli. The rest remains in the airways,
referred to as dead space volume). The maximal volume that you can exhale after
a maximal inhalation, is called vital capacity. Your vital capacity is about 4800 ml, which is almost 10
times your normal tidal volume at rest. A spirometer can measure lung capacity.
This is useful when diagnosing various lung diseases.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Gas Exchange and Transport
Occur Passively</b></span></div>
<div class="MsoNormal">
<b>Gases diffuse according to their partial pressures</b></div>
<div class="MsoNormal">
The primary gases of earth’s atmosphere are nitrogen (78%),
oxygen (21%), trace amounts of carbon dioxide (0.04%), and less than one
percent of all other gases combined. In this mixture of gases, each exerts a
partial pressure proportional to its percentage of total gas composition. The
pressure is not noticed by us because the pressure inside our lungs is the same
as the atmospheric pressure when we are resting between breaths.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>External respiration: The exchange of gases between air
and blood</b></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjNo_6s-QzChgQMf6WeEPbNbJ1j3gKnqchWMNPQXJB_svBBPxGmEV_W-aAF_4QcAyv-0EP28qu0g_XSE3IiRsxDu1-G-Fo74gtVmj_NTbsp7gHd78BgzlKeoPSNxGU-ayWq2xDW_w6XORYR/s1600/alveoli.jpg" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="214" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjNo_6s-QzChgQMf6WeEPbNbJ1j3gKnqchWMNPQXJB_svBBPxGmEV_W-aAF_4QcAyv-0EP28qu0g_XSE3IiRsxDu1-G-Fo74gtVmj_NTbsp7gHd78BgzlKeoPSNxGU-ayWq2xDW_w6XORYR/s320/alveoli.jpg" width="320" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Alveoli/shutterstock.com/accessed 4/11/12</td></tr>
</tbody></table>
<div class="MsoNormal">
Most of the air in our lungs is “old” air that has already
undergone some gas exchange. When venous, or deoxygenated, blood arrives from
the pulmonary arteries to the pulmonary capillaries, O2, or oxygen, diffuses
from the alveoli into the capillaries, and CO2, or carbon dioxide, diffuses in
the opposite direction. This results in partial pressure of oxygenated, or
arterial, blood leaving the lungs rising to 100 mm Hg (millimeters of mercury)
and the partial pressure of carbon dioxide falls to 40 mm Hg. Then oxygenated
blood is carried to the pulmonary veins to the heart and throughout the body in
the arterial blood vessels. The CO2 that diffused into the alveoli is exhaled along
with water vapor. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Internal respiration: The exchange of gases with tissue
fluids</b></div>
<div class="MsoNormal">
Both internal and external respiration occur via diffusion.
Your body’s cells get O2 for cellular respiration from the interstitial fluid
around them. Because your cells are constantly drawing this oxygen from the
fluid, the partial pressure of oxygen is lower than that of arterial blood.
Then as blood enters the capillaries, O2
diffuses into the interstitial fluid, which replenishes the O2 that has
been used by the cells. CO2, again, diffuses the opposite direction and goes
from cell, to interstitial fluid, to capillary blood. Partial pressure
gradients permitting diffusion are maintained by breathing, blood transport,
and cellular respiration. The effect being that homeostasis of O2 and CO2 in
your cells is well maintained.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Hemoglobin transports most oxygen molecules</b></div>
<div class="MsoNormal">
One of the most important functions of blood is to carry
oxygen from the lungs, to the tissues. It is transported either by binding to
hemoglobin in red blood cells, or by dissolving in blood plasma. Because O2 is
not very water soluble, only about 2% is dissolved in plasma. The other 98% binds to hemoglobin
molecules. Without hemoglobin, we would not receive enough oxygen to sustain
life. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Most CO2 is transported in plasma as biocarbonate</b></div>
<div class="MsoNormal">
The metabolism in our tissues is constantly producing CO2
waste. It diffuses easily from tissues to the bloodstream. Once it hits our
blood, it transports either by dissolving in blood plasma, binding to
hemoglobin, or converting to biocarbonate. In fact, 70% of CO2 converts to
biocarbonate. When biocarbonate is produced, CO2 combines with water (H2O) to
become carbonic acid (H2CO3). This is catalyzed by an enzyme called carbonic
anhydrase. The carbonic acid quickly breaks apart into bicarbonate and hydrogen
ions. The formation of bicarbonate from CO2 occurs in red blood cells because
this is where carbonic anhydrase is located. But bicarbonate diffuses quickly
from the red blood cells into plasma, where it returns to the lungs. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>The Nervous System
Regulates Breathing</b></span></div>
<div class="MsoNormal">
<b>A respiratory center establishes rhythm of breathing</b></div>
<div class="MsoNormal">
Skeletal muscle contractions are what allows our breathing
and these contractions are activated by motor neurons. This means that
respiration is controlled by our nervous system. The rate at which we breathe
is controlled by the medulla oblongata at the base of our brains. A group of
nerves called the respiratory center, generate electrical impulses every 4-5
seconds. The impulses travel along the nerves to the diaphragm and intercostal
muscles, which then contract. As they contract, the rib cage expands, the
diaphragm pulls downward, and we inhale. We have stretch receptors in our lungs
that send input back to our respiratory center, which monitors the degree of
and limits inflation, and starts exhalation. Once the nerve impulse ends, the muscles relax, the rib cage returns to normal size, the diaphragm
move upward again, and we exhale.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Chemical receptors monitor CO2, H+, and O2 levels</b></div>
<div class="MsoNormal">
Our bodies regulate rate and depth of breathing in order to
maintain homeostasis. This centers mainly on the regulation of CO2, H+, and O2
levels. It is through the detection of H+ concentrations that CO2 levels are
detected. The medulla oblongata does this via the cerebrospinal fluid
(interstitial fluid surrounding the cells in the brain). The rate and depth of
normal breathing is set by the need to get rid of CO2, not to obtain O2. </div>
<div class="MsoNormal">
<br /></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiQArOIqUjdCKrgR9fNtxCJZBs6Gh1AZAx6mQjtET5HlYsnALzL0V-uZEnOwLhyzMaC2rF8wXTv9gUq6m1VqCtdaQyekrfEG3YBL10uAYpxA_VNt7mImbnLnWYiBacOyTc471_nW488h3EW/s1600/consciousbreathing.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="212" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiQArOIqUjdCKrgR9fNtxCJZBs6Gh1AZAx6mQjtET5HlYsnALzL0V-uZEnOwLhyzMaC2rF8wXTv9gUq6m1VqCtdaQyekrfEG3YBL10uAYpxA_VNt7mImbnLnWYiBacOyTc471_nW488h3EW/s320/consciousbreathing.jpg" width="320" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Conscious Breathing/thinklifebalance.com/accessed 4/11/12</td></tr>
</tbody></table>
<div class="MsoNormal">
<b>We can exert some conscious control</b></div>
<div class="MsoNormal">
There is one other way we can regulate our breathing and
that is through conscious control. This control resides in our higher brain
centers in the cortex. Our ability to control breathing is what enables us to
speak, sing, hold our breath, and even hyperventilate for a short time.
Eventually, though, our automatic regulatory mechanisms kick back in and our
conscious control is overpowered. This could not be more demonstrated as when
we try to hold our breath.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: 14pt;"><b>Disorders of the
Respiratory System </b></span></div>
<div class="MsoNormal">
There are many factors that can lead to disorders of the
respiratory system:</div>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal"><b>Reduced
air flow or gas exchange impedes respiratory function</b><span style="font-weight: normal;"> – Anything that impedes air flow between the
atmosphere and the alveoli or diffusion of gas exchange between the alveolar
and capillary walls will impede respiratory function. These include:</span></li>
</ul>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc"><ul style="margin-top: 0in;" type="square"><ul style="margin-top: 0in;" type="square">
<li class="MsoNormal">Asthma
– spasmodic contraction of the bronchi</li>
<li class="MsoNormal">Emphysema
– in which alveoli become permanently impaired</li>
<li class="MsoNormal">Bronchitis
– inflammation of the bronchi</li>
<li class="MsoNormal">Cystic
fibrosis: an inherited condition</li>
</ul>
</ul>
</ul>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal"><b>Microorganisms
can cause respiratory disorders</b><span style="font-weight: normal;"> – The
lungs are particularly susceptible to infection due the their moist
lining, which microorganisms love. Some of these conditions include: </span></li>
</ul>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="square"><ul style="margin-top: 0in;" type="circle"><ul style="margin-top: 0in;" type="square">
<li class="MsoNormal">Colds
and flu: common respiratory infections</li>
<li class="MsoNormal">Pneumonia:
an infection that inflames the lungs</li>
<li class="MsoNormal">Tuberculosis:
a bacterial infection that scars the lungs</li>
<li class="MsoNormal">Botulism:
poisoning by a bacterial toxin</li>
</ul>
</ul>
</ul>
<div class="MsoNormal" style="margin-left: 1in;">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal"><b>Lung
cancer is caused by proliferation of abnormal cells</b><span style="font-weight: normal;"> – Cancer cells crowd out normal cells and
impair not only airflow, but gas exchange as well. Lung cancer accounts
for one-third of all cancer deaths in the U.S. It takes years to develop
and is highly preventable. 90% of lung cancer is caused by smoking or
exposure to secondhand smoke. The other 10% is caused by either radon gas
exposure or chemical exposure such as asbestos. </span></li>
</ul>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal"><b>Pneumothorax
and atalectasis: A failure of gas exchange</b><span style="font-weight: normal;"> – Pneumothorax refers to the collapse of one or more lobes of the
lungs and can be life-threatening. The most common cause is a penetrating
wound to the chest, which allows air into the pleural cavity around the
lungs. </span></li>
</ul>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal" style="margin-left: 0.5in;">
Atlectasis refers to a lack of gas exchange within the lungs
which results from alveolar collapse or buildup of fluid in the alveoli. This
means there is no exchange of gases between the atmosphere and the blood. This
can be caused by a compilation of surgery.</div>
<div class="MsoNormal" style="margin-left: 0.5in;">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal"><b>Congestive
heart failure impairs lung function</b><span style="font-weight: normal;"> –
Though congestive heart failure starts as a heart disorder, it can end by
impairing lung function. It causes fluid to build up in the interstitial
spaces between capillaries and alveoli and sometimes within alveoli
themselves. This reduces
diffusion of gases. Treatment for this focuses on reducing the fluid
buildup and improving the hearts pumping action.</span></li>
</ul>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
In summary, our body systems all have to work together to
maintain life. We are probably the most complicated, incredible machine in
existence today. When it works the way it was designed, we function at full
capacity and our abilities are bar none, off the charts. When things do not
work properly, even then, we have been given the ability to correct a great
deal. In my opinion, we are truly blessed, just by being human. The following article is one on little tricks, if you will, on how to maintain a healthy lifestyle.</div>
<a href="http://exercise.about.com/od/healthinjuries/a/healthylifestyl.htm" target="_blank">http://exercise.about.com/od/healthinjuries/a/healthylifestyl.htm</a>
<br />
<br />Vickihttp://www.blogger.com/profile/06412364992060613157noreply@blogger.com1tag:blogger.com,1999:blog-7781582437417706765.post-45706731580045081392012-03-12T17:16:00.001-07:002012-03-12T17:16:19.089-07:00My Chromosome and DNA and RNA Lab Part II<div style="font-family: Arial,Helvetica,sans-serif;">
<span style="font-size: small;"></span></div>
<div style="font-family: Arial,Helvetica,sans-serif;">
<span style="font-size: small;"><br /></span></div>
<div style="font-family: Arial,Helvetica,sans-serif;">
<span style="font-size: small;">In part II of this lab, the objective is to transcribe a sequence of DNA into RNA using the Y chromosome. Then we are to translate RNA into 10 amino acids of a polypeptide, as well as build a model of the DNA molecule with those 10 amino acids represented. Just to give you a little background: The Y chromosome is one of the sex chromosomes, the other being X. (Females have two XX chromosomes and a male has an X and a Y chromosome). DNA, or deoxyribonucleic acid, is the genetic material that directs everything a cell does. It is considered the key to life itself. RNA, or ribonucleic acid, is basically the messenger for DNA, responsible for carrying out DNA's instructions, and in some cases, regulating DNA. Proteins are created from 20 different amino acids and a string of 3-100 amino acids in considered a polypeptide. </span></div>
<div style="font-family: Arial,Helvetica,sans-serif;">
<span style="font-size: small;"><br /></span></div>
<div style="font-family: Arial,Helvetica,sans-serif;">
<span style="font-size: small;">To understand how to "crack" the code of translation from DNA to RNA, you need a basic understanding of what DNA consists of. DNA is a double helix and consists of a sugar group, a phosphate group, and one of four bases - adenine, thymine, guanine or cytosine. The double helix is formed as the bases pair up, thymine with adenine, and guanine with cytosine. RNA is a single strand, so that only one of the two DNA strands actually carries the genetic code for synthesis of RNA. One of the base pairs of RNA is different from DNA - thymine is uracil in RNA. And the sugar group for RNA is ribose rather than deoxyribose of DNA. </span></div>
<div style="font-family: Arial,Helvetica,sans-serif;">
<br /></div>
<div style="font-family: Arial,Helvetica,sans-serif;">
<span style="font-size: small;">A portion of the DNA molecule, representing a single gene, unwinds temporarily and a complementary strand of RNA is produced from the DNA strand. This process takes place in the nucleus. The RNA molecule that is produced is called messenger RNA or mRNA because it contains a template that can be translated into a specific sequence of amino acids that make up a particular protein. This message is encrypted as a triplet code or codon, because three bases make up one of 20 different amino acids. </span></div>
<div style="font-family: Arial,Helvetica,sans-serif;">
<span style="font-size: small;"><br /></span></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgi9HfNlCrLylkNkyoONtPnk4yOFj3N-IpPIAP3bylsWMPPf1pMbnKLpk6LraElWxL2XrNLtcabh1CK3-qD57GKhyphenhyphenPW7Oz0T3NqMKfIzu3WvHTrVYOaDlloOsOS1P3ITvtfMkEwBIMjHiMX/s1600/DNAdrawing.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="150" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgi9HfNlCrLylkNkyoONtPnk4yOFj3N-IpPIAP3bylsWMPPf1pMbnKLpk6LraElWxL2XrNLtcabh1CK3-qD57GKhyphenhyphenPW7Oz0T3NqMKfIzu3WvHTrVYOaDlloOsOS1P3ITvtfMkEwBIMjHiMX/s200/DNAdrawing.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Preliminary drawing of DNA strand</td></tr>
</tbody></table>
<div style="font-family: Arial,Helvetica,sans-serif;">
<span style="font-size: small;">To build my model of the DNA strand, I used jewelry beads and chain. My first step after translating my RNA to amino acids, was to draw it on paper to get a better feel for what I needed to do. Then I took my chain and formed it into a double helix. I took 30 headpins and placed them through the chain to anchor them. I color coded my base pairs as follow:</span></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjN9zKryHz5DedA3vvU_qVFbxe_VorPSCaUT_FhMCe0-o_3Q_6H9-7tkkNNOG0u6ph0DZ-3l_Daetd-HLfGK3KeM15BkLBPgpHfOEWXcQrDNnhBGY5Lwri99Aov0Lp5IPScmS89zVkDtDmr/s1600/DNAchainheadpinsplace.jpg" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="150" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjN9zKryHz5DedA3vvU_qVFbxe_VorPSCaUT_FhMCe0-o_3Q_6H9-7tkkNNOG0u6ph0DZ-3l_Daetd-HLfGK3KeM15BkLBPgpHfOEWXcQrDNnhBGY5Lwri99Aov0Lp5IPScmS89zVkDtDmr/s200/DNAchainheadpinsplace.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Beginning the process of DNA</td></tr>
</tbody></table>
<div style="font-family: Arial,Helvetica,sans-serif;">
<br /></div>
<div style="font-family: Arial,Helvetica,sans-serif;">
<br /></div>
<div style="font-family: Arial,Helvetica,sans-serif;">
<br /></div>
<div style="font-family: Arial,Helvetica,sans-serif;">
<span style="font-size: small;">C or Cytosine = purple seed beads</span></div>
<div style="font-family: Arial,Helvetica,sans-serif;">
<span style="font-size: small;">G or guanine = silver seed beads</span></div>
<div style="font-family: Arial,Helvetica,sans-serif;">
<span style="font-size: small;">T or thymine = green seed beads</span></div>
<div style="font-family: Arial,Helvetica,sans-serif;">
<span style="font-size: small;">A or adenine = red seed beads</span></div>
<div style="font-family: Arial,Helvetica,sans-serif;">
<br /></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg1vRDpLCyVpcUMjwhTiP_kCCv6txacsJNmja2a-is5HTwTPQiCsyCd5sD1kdFGodhnrU0OlYrZI8tjCD6RxA2aOGf9JPxXgnpqvUCW2TalYFC9WDMP0QF4rOai4hjaYO37YM17b7VHVxd8/s1600/DNAinprogress3.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="150" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg1vRDpLCyVpcUMjwhTiP_kCCv6txacsJNmja2a-is5HTwTPQiCsyCd5sD1kdFGodhnrU0OlYrZI8tjCD6RxA2aOGf9JPxXgnpqvUCW2TalYFC9WDMP0QF4rOai4hjaYO37YM17b7VHVxd8/s200/DNAinprogress3.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">In process of creating DNA</td><td class="tr-caption" style="text-align: center;"><br /></td><td class="tr-caption" style="text-align: center;"><br /></td></tr>
</tbody></table>
<div style="font-family: Arial,Helvetica,sans-serif;">
<span style="font-size: small;">I also used tube beads to represent the hydrogen bond between the base pairings. Hydrogen bonds hold the pairs together, like glue. I placed my beads on the headpins, following my code of DNA and secured my headpin on the other side of my helix (chain). </span></div>
<div style="font-family: Arial,Helvetica,sans-serif;">
<span style="font-size: small;"><br /></span></div>
<div style="font-family: Arial,Helvetica,sans-serif;">
<br /></div>
<div style="font-family: Arial,Helvetica,sans-serif;">
<br /></div>
<div style="font-family: Arial,Helvetica,sans-serif;">
<br /></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj0YNo1y9tI58jfhOEvNGhqu6eqXBc5y7D0z-GDDBxdZMo8zyrKrJ4k_LzsZ0WOsPv8DJPFJe6dUI4sIOuKzt5X5YnjW2BPNlLsIG3J30U-jRxK7afslBXRZyYUob-MS8Zw3ZaX2zGtEGt7/s1600/DNAstrandcloseup.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="178" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj0YNo1y9tI58jfhOEvNGhqu6eqXBc5y7D0z-GDDBxdZMo8zyrKrJ4k_LzsZ0WOsPv8DJPFJe6dUI4sIOuKzt5X5YnjW2BPNlLsIG3J30U-jRxK7afslBXRZyYUob-MS8Zw3ZaX2zGtEGt7/s320/DNAstrandcloseup.jpg" width="320" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Closeup of DNA strand</td></tr>
</tbody></table>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhbpF-tFWGCCgsMVKbZnomr2DXabS3M8nfMI36iiyyiYH_JfBgo6o1xHDpVM34EX0yqLi9wIUpwApxvGcKnrZkpvCxJPFVDw9obzSUr1ivLOXnzuX1F_Q7_EpddmiYVNuItH5wqrVqrc5VE/s1600/DNAstrandcomplete.jpg" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="121" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhbpF-tFWGCCgsMVKbZnomr2DXabS3M8nfMI36iiyyiYH_JfBgo6o1xHDpVM34EX0yqLi9wIUpwApxvGcKnrZkpvCxJPFVDw9obzSUr1ivLOXnzuX1F_Q7_EpddmiYVNuItH5wqrVqrc5VE/s200/DNAstrandcomplete.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Complete DNA strand</td></tr>
</tbody></table>
<div style="font-family: Arial,Helvetica,sans-serif;">
<br /></div>
<div style="font-family: Arial,Helvetica,sans-serif;">
<br /></div>
<div style="font-family: Arial,Helvetica,sans-serif;">
<br /></div>
<div style="font-family: Arial,Helvetica,sans-serif;">
<br /></div>
<div style="font-family: Arial,Helvetica,sans-serif;">
<span style="font-size: small;"><br /></span></div>
<br />
<br />
<br />
<br />
<br />
<br />
<div style="font-family: Arial,Helvetica,sans-serif;">
<br /></div>
<div style="font-family: Arial,Helvetica,sans-serif;">
<br /></div>
<div style="font-family: Arial,Helvetica,sans-serif;">
<br /></div>
<div style="font-family: Arial,Helvetica,sans-serif;">
<br /></div>
<div style="font-family: Arial,Helvetica,sans-serif;">
<br /></div>
<div style="font-family: Arial,Helvetica,sans-serif;">
<span style="font-size: small;">The following was my original DNA strand from the Y chromosome:</span></div>
<style>
@font-face {
font-family: "Times New Roman";
}p.MsoNormal, li.MsoNormal, div.MsoNormal { margin: 0in 0in 0.0001pt; font-size: 12pt; font-family: "Times New Roman"; }pre { margin: 0in 0in 0.0001pt; font-size: 10pt; font-family: Courier; }table.MsoNormalTable { font-size: 10pt; font-family: "Times New Roman"; }span.ffline { }div.Section1 { page: Section1; }
</style>
<br />
<pre style="font-family: Arial,Helvetica,sans-serif;"><span style="font-size: small;"><span class="ffline"><span><b>CCTTCCTCTCTCTCTCTCTCTCTCTCTCTCTCTCCTGACTTTCTGTCTCTTCCTCTGTCTCTCTGTTTCT</b></span></span><span><b> </b></span></span></pre>
<pre style="font-family: Arial,Helvetica,sans-serif;"><span style="font-size: small;"><span><b> </b></span></span></pre>
<pre style="font-family: Arial,Helvetica,sans-serif;"><span style="font-size: small;"><span>We were only asked to translate the first 10 codons. It is easier to see if you put a space between every three bases.</span></span></pre>
<pre style="font-family: Arial,Helvetica,sans-serif;"><span style="font-size: small;"><span> </span><span class="ffline"><span><b><b>CCT TCC TCT CTC TCT CTC TCT CTC TCT CTC</b></b></span></span></span></pre>
<pre style="font-family: Arial,Helvetica,sans-serif;"><span style="font-size: small;"><span class="ffline"><span><b><b> </b></b></span></span></span></pre>
<pre style="font-family: Arial,Helvetica,sans-serif;"><span style="font-size: small;"><span class="ffline"><span>Next, we translate this to RNA: Remember that C and G are paired and T and A are paired. And any T (thymine) will now be uracil or U. </span></span></span></pre>
<pre style="font-family: Arial,Helvetica,sans-serif;"><b><span style="font-size: small;"><span class="ffline"><span>GGA AGG AGA GAG AGA GAG AGA GAG AGA GAG</span></span></span></b></pre>
<pre style="font-family: Arial,Helvetica,sans-serif;"><span style="font-size: small;"><span class="ffline"><span> </span></span></span></pre>
<pre style="font-family: Arial,Helvetica,sans-serif;"><span style="font-size: small;"><span class="ffline"><span>In my particular strand of DNA, you will notice there are no U's. Uracil did not occur until later in my strand.</span></span></span></pre>
<pre style="font-family: Arial,Helvetica,sans-serif;"><span style="font-size: small;"><span class="ffline"><span> </span></span></span></pre>
<pre style="font-family: Arial,Helvetica,sans-serif;"><span style="font-size: small;"><span class="ffline"><span>Next, I translated my RNA into my ten amino acids using the chart on page 412 of our textbook:</span></span></span></pre>
<pre style="font-family: Arial,Helvetica,sans-serif;"><span style="font-size: small;"><span class="ffline"><span>
</span></span></span></pre>
<pre style="font-family: Arial,Helvetica,sans-serif;"><span style="font-size: small;"><span class="ffline"><span>1 - glycine (Gly)</span></span></span></pre>
<pre style="font-family: Arial,Helvetica,sans-serif;"><span style="font-size: small;"><span class="ffline"><span>2 - argenine (Arg)</span></span></span></pre>
<pre style="font-family: Arial,Helvetica,sans-serif;"><span style="font-size: small;"><span class="ffline"><span>3 - argenine (Arg)</span></span></span></pre>
<pre style="font-family: Arial,Helvetica,sans-serif;"><span style="font-size: small;"><span class="ffline"><span>4 - glutamic acid (Glu)</span></span></span></pre>
<pre style="font-family: Arial,Helvetica,sans-serif;"><span style="font-size: small;"><span class="ffline"><span>5 - argenine (Arg)</span></span></span></pre>
<pre style="font-family: Arial,Helvetica,sans-serif;"><span style="font-size: small;"><span class="ffline"><span>6 - glutamic acid (Glu)</span></span></span></pre>
<pre style="font-family: Arial,Helvetica,sans-serif;"><span style="font-size: small;"><span class="ffline"><span>7 - argenine (Arg)</span></span></span></pre>
<pre style="font-family: Arial,Helvetica,sans-serif;"><span style="font-size: small;"><span class="ffline"><span>8 - glutamic acid (Glu)</span></span></span></pre>
<pre style="font-family: Arial,Helvetica,sans-serif;"><span style="font-size: small;"><span class="ffline"><span>9 - argenine (Arg)</span></span></span></pre>
<pre style="font-family: Arial,Helvetica,sans-serif;"><span style="font-size: small;"><span class="ffline"><span>10 - glutamic acid (Glu) </span></span></span></pre>
<pre style="font-family: Arial,Helvetica,sans-serif;"><span style="font-size: small;"><span class="ffline"><span>
</span></span></span></pre>
<pre style="font-family: Arial,Helvetica,sans-serif;"><span style="font-size: small;"><span class="ffline"><span>The model represents the first 10 base pairs of a DNA strand from a Y chromosome. This was actually a very enlightening experience.</span></span></span></pre>
<pre style="font-family: Arial,Helvetica,sans-serif;"><span style="font-size: small;"><span class="ffline"><span>After doing some research, I began to understand a little bit more about the process of forming a protein.</span></span></span></pre>
<pre style="font-family: Arial,Helvetica,sans-serif;"><span style="font-size: small;"><span class="ffline"><span>The Central Dogma in molecular biology states that DNA is transcribed into RNA, which is transcribed into protein.</span></span></span></pre>
<pre style="font-family: Arial,Helvetica,sans-serif;"><span style="font-size: small;"><span class="ffline"><span>Protein is never back-translated into DNA or RNA. And except for retroviruses, DNA is never created from RNA. And</span></span></span></pre>
<pre style="font-family: Arial,Helvetica,sans-serif;"><span style="font-size: small;"><span class="ffline"><span>DNA is never translated to protein. There is a very specific transfer process of sequential information. </span></span></span></pre>
<pre style="font-family: Arial,Helvetica,sans-serif;"><span style="font-size: small;"><span class="ffline"><span>
</span></span></span></pre>
<pre style="font-family: Arial,Helvetica,sans-serif;"><span style="font-size: small;"><span class="ffline"><span><b><b>Sources:</b></b></span></span></span></pre>
<pre style="font-family: Arial,Helvetica,sans-serif;"><span style="font-size: small;"><span class="ffline"><span><b><b>DNAi.org</b></b></span></span></span></pre>
<pre style="font-family: Arial,Helvetica,sans-serif;"><span style="font-size: small;"><span class="ffline"><span><b><b>Human Biology, 6th Edition, Michael D. Johnson</b></b></span></span></span></pre>
<pre style="font-family: Arial,Helvetica,sans-serif;"><span style="font-size: small;"><span class="ffline"><span><b><b>cnx.org</b></b></span></span></span></pre>
<pre style="font-family: Arial,Helvetica,sans-serif;"><span style="font-size: small;"><span class="ffline"><span><b><b>wikipedia.org</b></b></span></span></span></pre>
<pre style="font-family: Arial,Helvetica,sans-serif;"><span style="font-size: small;"><span class="ffline"><span><b><b>And many thanks to faculty.yc.edu/lfrolich for this wonderful website.</b></b></span></span></span></pre>
<pre style="font-family: Arial,Helvetica,sans-serif;"><span style="font-size: small;"><span class="ffline"><span><b><b>And to Nina, for pointing me in the right direction.</b></b></span></span></span></pre>
<pre style="font-family: Arial,Helvetica,sans-serif;"><span style="font-size: small;"><span class="ffline"><span><b><b> </b></b></span></span></span></pre>
<pre style="font-family: Arial,Helvetica,sans-serif;"><span style="font-size: small;"><span class="ffline"><span><b><b> </b></b></span></span></span></pre>
<pre><span style="font-size: 14pt;"><b><span style="font-size: small;"><span style="font-family: Arial,Helvetica,sans-serif;"> </span></span></b></span></pre>Vickihttp://www.blogger.com/profile/06412364992060613157noreply@blogger.com0tag:blogger.com,1999:blog-7781582437417706765.post-23979177560897528922012-03-12T12:28:00.001-07:002012-03-12T12:39:47.491-07:00<span style="font-size: small;">BIO156 / Lab Project / My Chromosome and DNA and RNA</span><br />
<span style="font-size: small;"><br /></span><br />
<span style="font-size: small;">Part I:</span><br />
<span style="font-size: small;"><br /></span><br />
<style>
@font-face {
font-family: "Times New Roman";
}p.MsoNormal, li.MsoNormal, div.MsoNormal { margin: 0in 0in 0.0001pt; font-size: 12pt; font-family: "Times New Roman"; }p { margin-right: 0in; margin-left: 0in; font-size: 10pt; font-family: Times; }table.MsoNormalTable { font-size: 10pt; font-family: "Times New Roman"; }div.Section1 { page: Section1; }
</style>
<br />
<span style="font-size: small;">The objective of part one of this lab was to be able to interpret and
communicate the information that genes hold and to become a little more
appreciative of the Human Genome. There are three billion pairs of human DNA
and they are packed onto 46 separate structures called chromosomes. These
chromosomes also contain histones, or proteins, that convey structure to
the chromosome molecule. A gene is a short segment of the DNA that contains the
recipe for one or more proteins. There are approximately 20,000 genes on the 46
chromosomes. The chromosome I was assigned was number 11. The following are the
8 genes I picked from chromosome 11: </span><br />
<br />
<span style="font-size: small;"><br /></span><br />
<span style="font-size: small;">1. INS or insulin. The binding of insulin to the insulin receptor (NSR), stimulates glucose uptake. There have been a number of mutant alleles identified with phenotypic effect or traits.</span><br />
<span style="font-size: small;"><br /></span><br />
<span style="font-size: small;">2. WT1 or Wilms tumor. This gene is essential in normal development of the urogenital system. When it mutates you have Wilms tumor.</span><br />
<span style="font-size: small;"><br /></span><br />
<span style="font-size: small;">3. APOA1 or apolipoprotein A-1. This gene encodes apolipoprotein A-1, which is a major component in HDL in plasma. It promotes cholesterol efflux from tissues to the liver for excretion. Defects are associated with HDL deficiencies, including Tangier disease.</span><br />
<span style="font-size: small;"><br /></span><br />
<span style="font-size: small;">4. HBB or Hemoglobin beta. This gene determines structure of two types of polypeptide chains in adult hemoglobin HbA. Mutant beta globin causes sickle cell anemia.</span><br />
<span style="font-size: small;"><br /></span><br />
<span style="font-size: small;">5. F2 or Coagulation factor II (thrombin). This gene forms thrombin in the first step of the coagulation cascade, which results in stemming blood loss. It also plays a role in maintaining vascular integrity during development and postnatal life. Mutations lead to various forms of thrombosis and dysprothrombinemia.</span><br />
<span style="font-size: small;"><br /></span><br />
<span style="font-size: small;">6. IGF2 or insulin-like growth factor (somatomedia A). This gene encodes a member of the insulin family of polypeptide growth factors, which are involved in development and growth. It is an imprinted gene, only from the paternal allele. Epigenetic changes are associated with Wilms tumor, Beekwith-Wiedemann syndrome, Silver-Russell syndrome, and rhabdomyosarcoma.</span><br />
<span style="font-size: small;"><br /></span><br />
<span style="font-size: small;">7. PGR or progesterone receptor. This gene encodes a member of the steroid receptor superfamily. The encoded protein mediates physiological effects of progesterone, which plays a central role in reproductive events associated with establishing and maintaining pregnancy.</span><br />
<span style="font-size: small;"><br /></span><br />
<span style="font-size: small;">8. DRD4 or Dopamine receptor D4. This gene encodes a subtype of the dopamine receptor. It is a G-protein coupled receptor which inhibits adenylyl cyclase. It is a target for drugs that treat schizophrenia and Parkinson's disease. Mutations are associated with behavorial phenotypes, including autonomic nervous system dysfunction, ADD, and the personality trait of novelty seeking.</span><br />
<span style="font-size: small;"><br /></span><br />
<style>
@font-face {
font-family: "Times New Roman";
}p.MsoNormal, li.MsoNormal, div.MsoNormal { margin: 0in 0in 0.0001pt; font-size: 12pt; font-family: "Times New Roman"; }p { margin-right: 0in; margin-left: 0in; font-size: 10pt; font-family: Times; }table.MsoNormalTable { font-size: 10pt; font-family: "Times New Roman"; }div.Section1 { page: Section1; }
</style>
<br />
<span style="font-size: small;">The human genome is all of the DNA that comprises us as humans. It takes a
bit of real study to even begin to understand how it all fits together, from
your basic elements into a human body that functions in this world that we call
life. It seems to me that we are comprised of universe after universe within
our bodies. The Human Genome Project is an amazing program attempting to define
all of the genes within our makeup, which is a huge undertaking, but one that
will be of enormous benefit to our species. These 8 genes are just the tip of
the iceberg. If I had to pick a favorite, I would say PGR, or progesterone
receptor. Mainly because I, myself, have had some issues with this
hormone. </span><br />
<br />
<span style="font-size: small;">Sources: </span><br />
<span style="font-size: small;">medterms.com</span><br />
<span style="font-size: small;">DNAi.org</span><br />
<span style="font-size: small;">Human Biology, 6th Edition, Michael D. Johnson</span><br />
<br />
<br />Vickihttp://www.blogger.com/profile/06412364992060613157noreply@blogger.com0tag:blogger.com,1999:blog-7781582437417706765.post-33755309562084504362012-03-08T20:39:00.001-08:002012-03-08T20:49:49.684-08:00<span style="font-size: large;"><b>Human Biology/Compilation II, Chapters 17-20</b></span><br />
<span style="font-size: large;"><b><span style="font-size: small;">Table of Contents </span></b></span><br />
<div style="color: red;">
<span style="font-size: large;"><b><span style="font-size: small;">Cell Reproduction and Differentiation</span></b></span></div>
<span style="font-size: large;"><b><span style="font-size: small;"> </span></b><span style="font-size: small;">- The cell cycle creates new cells</span></span><br />
<span style="font-size: large;"><span style="font-size: small;"> - Replication, transcription, and translation: An overview </span></span><br />
<span style="font-size: large;"><span style="font-size: small;"> - Cell reproduction: One cell becomes two</span></span><br />
<span style="font-size: large;"><span style="font-size: small;"> - How cell reproduction is regulated</span></span><br />
<span style="font-size: large;"><span style="font-size: small;"> - Environmental factors influence cell differentiation</span></span><br />
<span style="font-size: large;"><span style="font-size: small;"> - Cloning an organism requires an undifferentiated cell</span></span><br />
<span style="font-size: large;"><span style="font-size: small;"> - Therapeutic cloning: Creating tissues and organs</span></span><br />
<br />
<span style="font-size: large;"><span style="font-size: small;"><b style="color: red;">Cancer: Uncontrolled Cell Division and Differentiation </b></span></span><br />
<span style="font-size: large;"><span style="font-size: small;"><b style="color: red;"> </b><span style="color: red;"><span style="color: black;"> - Tumors can be benign or cancerous</span></span></span></span><br />
<span style="font-size: large;"><span style="font-size: small;"><span style="color: red;"><span style="color: black;"> - Cancerous cells lose control of their functions and structures</span></span></span></span><br />
<span style="font-size: large;"><span style="font-size: small;"><span style="color: red;"><span style="color: black;"> - How cancer develops</span></span></span></span><br />
<span style="font-size: large;"><span style="font-size: small;"><span style="color: red;"><span style="color: black;"> - Advances in diagnosis enable early detection</span></span></span></span><br />
<span style="font-size: large;"><span style="font-size: small;"><span style="color: red;"><span style="color: black;"> - Cancer treatments</span></span></span></span><br />
<span style="font-size: large;"><span style="font-size: small;"><span style="color: red;"><span style="color: black;"> - The 10 most common cancers</span></span></span></span><br />
<span style="font-size: large;"><span style="font-size: small;"><span style="color: red;"><span style="color: black;"> - Most cancers can be prevented</span></span></span></span><br />
<br />
<span style="font-size: large;"><span style="font-size: small;"><b style="color: red;"> Genetics and Inheritance</b></span></span><br />
<span style="font-size: large;"><span style="font-size: small;"><b style="color: red;"> </b><span style="color: red;"><span style="color: black;"> - Your genotype is the genetic basis of your phenotype </span></span></span></span><br />
<span style="font-size: large;"><span style="font-size: small;"><span style="color: red;"><span style="color: black;"> - Genetic inheritance follows certain patterns</span></span></span></span><br />
<span style="font-size: large;"><span style="font-size: small;"><span style="color: red;"><span style="color: black;"> - Other dominance patterns</span></span></span></span><br />
<span style="font-size: large;"><span style="font-size: small;"><span style="color: red;"><span style="color: black;"> - Other factors influence inheritance patterns and phenotype</span></span></span></span><br />
<span style="font-size: large;"><span style="font-size: small;"><span style="color: red;"><span style="color: black;"> - Sex-linked inheritance: X and Y chromosomes carry different genes</span></span></span></span><br />
<span style="font-size: large;"><span style="font-size: small;"><span style="color: red;"><span style="color: black;"> - Chromosomes may be altered in number or structure</span></span></span></span><br />
<span style="font-size: large;"><span style="font-size: small;"><span style="color: red;"><span style="color: black;"> - Many inherited genetic disorders involve recessive alleles</span></span></span></span><br />
<span style="font-size: large;"><span style="font-size: small;"><span style="color: red;"><span style="color: black;"> - Genes code for proteins, not for specific behaviors</span></span></span></span><br />
<br />
<span style="font-size: large;"><span style="font-size: small;"><b><span style="color: red;">DNA Technology and Genetic Engineering </span></b></span></span><br />
<span style="font-size: large;"><span style="font-size: small;"><b><span style="color: red;"> </span></b><span style="color: red;"><span style="color: black;">- DNA sequencing reveals structure of DNA </span></span></span></span><br />
<span style="font-size: large;"><span style="font-size: small;"><span style="color: red;"><span style="color: black;"> - DNA can be cloned in the laboratory</span></span></span></span><br />
<span style="font-size: large;"><span style="font-size: small;"><span style="color: red;"><span style="color: black;"> - Genetic engineering creates transgenic organisms</span></span></span></span><br />
<span style="font-size: large;"><span style="font-size: small;"><span style="color: red;"><span style="color: black;"> - Gene therapy: The hope of the future? </span></span></span></span><br />
<span style="font-size: large;"><b><span style="font-size: small;"> </span></b></span><br />
<span style="font-size: large;"><b><span style="font-size: small;"><br /></span></b></span><br />
<span style="font-size: large;"><b><span style="font-size: small;"><br /></span></b></span><br />
<span style="font-size: large;"><b><span style="font-size: small;"></span></b></span><br />
<br />
<br />
<span style="font-size: large;"><b></b></span><br />
<div style="color: red;">
<span style="font-size: large;">Cell Reproduction and Differentiation</span></div>
<br />
In multicellular organisms, cell division and growth are what allows that organism to grow. Amazingly, a human life starts out as a single cell and by the time you are born, you consist of over 10 trillion cells! Cell division continues throughout your life, especially during childhood and adolescence. Red blood cells alone are replaced every 120 days, which works out to 175 million cell divisions every minute!<br />
<br />
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgSEyq4ZfuZjlry8qUTle3uS6SRWRkKWLu-6Vah7taSFRbuckvtgdqZGnXlY5t9zq7SCLrnwdLDFuPWMpr4VMsGP6eAh0GuToJfC4PK0NXYXTZNKxeHoEk1c5TV2KQ-ZrfUWUOx7iH5ANzj/s1600/celldivision.jpg" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="138" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgSEyq4ZfuZjlry8qUTle3uS6SRWRkKWLu-6Vah7taSFRbuckvtgdqZGnXlY5t9zq7SCLrnwdLDFuPWMpr4VMsGP6eAh0GuToJfC4PK0NXYXTZNKxeHoEk1c5TV2KQ-ZrfUWUOx7iH5ANzj/s200/celldivision.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Cell Division / visualphotos.com / accessed 3/8/12</td></tr>
</tbody></table>
<span style="font-size: small;"><b>The Cell Cycle Creates New Cells</b></span><br />
The cell cycle is defined as the creation of new cells from existing cells via a repetitive sequence of events. There are two phases: interphase and the mitotic phase.<br />
<br />
Interphase is the longer of the two phases, during which cells grow and DNA is duplicated. Interphase is divided into three subphases: G1, S and G2. G1 stands for "first gap", which is the period between the last cell division and DNA synthesis. S phase stands for "synthesis". During this phase chromosomes are duplicated. And during G2 or "second gap", the cell continues growth in preparation for cell division.<br />
<br />
In the mitotic phase there are two subphases: mitosis and cytokinesis. In mitosis, the DNA is divided into two sets and the nucleus divides. In cytokinesis, the cytoplasm divides and two new "daughter" cells are formed. <br />
<br />
<span style="font-size: small;"><b>Replication, Transcription, and Translation: An Overview</b></span><br />
There are three billion pairs of DNA on 46 chromosomes in a human. Chromosomes organize and arrange the DNA inside the nucleus. Because DNA represents all instructions for life, when a cell divides, it must have the exact same DNA <b>every time</b> it splits or divides. DNA replication, then, is the process of copying the DNA before the cell divides. Transcription is the process by which the DNA code of a single gene is converted to a single strand of messenger RNA (a gene being the smallest unit of a chromosome). DNA/chromosomes are too big to pass through the nucleus, so it must convert to a smaller form to pass into the cytoplasm. And translation is the process of converting mRNA into proteins.<br />
<br />
<div style="color: purple;">
<div class="separator" style="clear: both; text-align: center;">
</div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhk63S74gs3FZxJ8QTcLeNmAVIZcPtXR3nLrgcL5Ytt_r9X3JlNad3Jz1TAmsbffr2wzWF5DeWNnajO94dBTv-e1QWtEdn99tv18ttTSKIjPrlRSXftzXKWIQ6gR8rJztvjlG7oXnBqospO/s1600/dnastrand.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="150" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhk63S74gs3FZxJ8QTcLeNmAVIZcPtXR3nLrgcL5Ytt_r9X3JlNad3Jz1TAmsbffr2wzWF5DeWNnajO94dBTv-e1QWtEdn99tv18ttTSKIjPrlRSXftzXKWIQ6gR8rJztvjlG7oXnBqospO/s200/dnastrand.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">DNA Strand / getfreeimage.com / accessed 3/8/12</td></tr>
</tbody></table>
<span style="font-size: small;"><b>Replication: Copying DNA before cell division</b></span></div>
<div style="color: black;">
Remember that DNA is a double stranded helix. When it replicates, enzymes at various points along the helix unwind a portion of the DNA. This creates a bubble in the two strands and new strands begin to form in the bubble. This proceeds outward in opposite directions until until the replication bubbles join. This happens at thousands of sites at once, making the process very quick, 7-8 hours, to be exact. </div>
<div style="color: black;">
<br /></div>
<div style="color: black;">
<span style="font-size: small;"><b><span style="color: purple;">Mutations are alterations in DNA </span></b></span></div>
<div style="color: black;">
Any alteration in the DNA is a mutation. It can be caused by a mistake in the replication process as well as by chemical or physical forces that damage a segment. If these errors are not corrected before duplication, cancer may result. It can also be passed along to future generations, depending on where the mutation is located. </div>
<div style="color: black;">
<br /></div>
<div style="color: purple;">
<span style="font-size: small;"><b>Mechanisms of DNA repair</b></span></div>
<div style="color: black;">
There are numerous enzymes that actually repair DNA damage. They can cut out damaged sections as well as reconnect its backbone. This process is most active between the replication process and the beginning of mitosis. This way, the best possible copy is passed on to the daughter cell. If the damaged genes are the ones that actually control the repair process, then mutated DNA may accumulate faster than normal. This has been connected to an increased risk of colon and breast cancer.</div>
<div style="color: black;">
<br /></div>
<div style="color: black;">
<span style="font-size: small;"><b style="color: purple;">Transcription: Converting a gene's code into mRNA</b></span></div>
<div style="color: black;">
Transcription, again, converts a single gene code into mRNA. It is very similar to the replication process except that only one segment of DNA and one single gene unwind, instead of the entire molecule. Because RNA is a single strand, only one of the two strands has the genetic code that specifies the synthesis of RNA. Also, RNA carries a base of uracil instead of thymine, like DNA. And the sugar of RNA is ribose, rather than deoxyribose. The mRNA attaches to a ribosome, which is the template for protein synthesis.</div>
<div style="color: black;">
<br /></div>
<div style="color: black;">
<span style="font-size: small;"><b><span style="color: purple;">Translation: Making a protein from RNA</span></b></span></div>
<div style="color: black;">
There are three steps to the translation process, which converts RNA to protein. </div>
<div style="color: black;">
</div>
<ul>
<li><b>Initiation</b>: a tRNA (transfer molecule), binds to two ribosome subunits and the mRNA molecule. This moves along the mRNA until they find a "start" codon. Then they are joined by a larger ribosomal subunit to form an intact ribosome and this holds the mRNA in place while the tRNA tranports amino acids to it.</li>
</ul>
<div style="color: black;">
</div>
<ul>
<li><b>Elongation</b>: The tRNA captures amino acids and brings it to mRNA. As mRNA passes between two ribosomal subunits, the ribosome binds to the tRNA, which basically glues the the bond between the new and "old" amino acid. The tRNA is then freed to find more amino acids. This forms the long chain one amino acid at a time.</li>
</ul>
<br />
<div style="color: black;">
</div>
<span style="font-size: small;"><b>Cell Reproduction: One Cell Becomes Two<span style="color: purple;"> </span></b></span><br />
<span style="font-size: small;"><b><span style="color: purple;">Mitosis: Daughter cells are identical to the parent cell</span></b></span><br />
<style>
@font-face {
font-family: "Times New Roman";
}p.MsoNormal, li.MsoNormal, div.MsoNormal { margin: 0in 0in 0.0001pt; font-size: 12pt; font-family: "Times New Roman"; }table.MsoNormalTable { font-size: 10pt; font-family: "Times New Roman"; }div.Section1 { page: Section1; }
</style>
<br />
<div class="MsoNormal">
Mitosis, again, is the process of nuclear division, where
the sister chromatids of the duplicated chromosomes separate. After mitosis,
each daughter cell has an identical set of DNA to the parent cell. And although
there are very defined phases for mitosis, it is a seamless process.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Prophase</b> -
begins when you can first see the duplicated chromosomes. In this phase, the
tubular elements of the cytoskeleton come apart and reassemble between pairs of
centrioles.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Metaphase</b> - could be described as a tug-of-war, where
molecules are pulled in opposite directions, but do not separate yet.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Anaphase</b> - here, the molecules separate abruptly and move to
opposite cell sides. ATP energy is
required for this step.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<b>Telophase</b> -
Once two sets of chromosomes have reached opposite polar ends, telophase
begins. In this phase, new nuclear membranes form around the chromosomes after
the mitotic spindle comes apart.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<style>
@font-face {
font-family: "Times New Roman";
}p.MsoNormal, li.MsoNormal, div.MsoNormal { margin: 0in 0in 0.0001pt; font-size: 12pt; font-family: "Times New Roman"; }table.MsoNormalTable { font-size: 10pt; font-family: "Times New Roman"; }div.Section1 { page: Section1; }
</style>
</div>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b>Cytokinesis divides one cell into two identical cells</b></span></div>
<div class="MsoNormal">
Cytokinesis was the forerunner to our delivery and recycle
systems. Living cells had it down way before we did. This is the process used
to divide a cell into two daughter cells. A contractile ring is assembled just
before it is needed from the remnants of the cytoskeleton. This ring tightens
and pinches the cell in two. Then the ring disassembles to form new
cytoskeletons. Quite amazing, actually.</div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgTxzmf4m86zbn4fsovUIdnNCOCu-1LAEcGVErbAtl2Bxml4y6xsYUR0rup-X9-Ux2BDB9ayC4tDrSxJDlWZWxcCKlXeoYNC-sB3iL3S-II_Dz-_-KHX8opnKv0d33hB-wQVRz39LRflvVc/s1600/mitosis.jpg" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="160" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgTxzmf4m86zbn4fsovUIdnNCOCu-1LAEcGVErbAtl2Bxml4y6xsYUR0rup-X9-Ux2BDB9ayC4tDrSxJDlWZWxcCKlXeoYNC-sB3iL3S-II_Dz-_-KHX8opnKv0d33hB-wQVRz39LRflvVc/s200/mitosis.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Mitosis / shutterstock.com / accessed 3/8/12</td></tr>
</tbody></table>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b>Mitosis produces diploid cells, and meiosis produces
haploid cells</b></span><br />
<b><span style="font-size: small;"><a href="http://www.youtube.com/watch?v=ZEwddr9ho-4&feature=related" target="_blank">Mitosis Dance Video</a> <span style="color: black;">(It takes a few minutes to watch, but is awesome and very creative).</span></span></b></div>
<div class="MsoNormal">
Diploid cells are human cells that have 46 chromosomes (23
pairs). They reproduce by undergoing mitosis. Sperm and egg cells are haploid
cell, which only have one set of 23 chromosomes. These cells are created by
meiosis. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b>Meiosis: Preparing for sexual reproduction </b></span></div>
<div class="MsoNormal">
Meiosis is the sequence of two nuclear divisions where the
human genes are mixed, reshuffled and reduced by half. Once fertilization
occurs, this egg and all subsequent cells become diploid. Meiosis I and II have
four stages: prophase, metaphase, anaphase, and telophase. </div>
<div class="MsoNormal">
<br /></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhM-jgroLo3O1SxAdwaQ-_s0hOttxN_IK-ipz_R0EmT2mutxpaosManQIOXpKoSWk6J7Qr2ZUn73sVa3eh-K7N-5j5R-oYaTjfdx3IFG0wMEaFMJD-slGTFLToHKPV8gyGfdKijaDb4pGJX/s1600/plantcellinmeiosis.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="200" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhM-jgroLo3O1SxAdwaQ-_s0hOttxN_IK-ipz_R0EmT2mutxpaosManQIOXpKoSWk6J7Qr2ZUn73sVa3eh-K7N-5j5R-oYaTjfdx3IFG0wMEaFMJD-slGTFLToHKPV8gyGfdKijaDb4pGJX/s200/plantcellinmeiosis.jpg" width="176" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Plant Cell Meosis / nature.com / accessed 3/8/12</td></tr>
</tbody></table>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b>Sex differences in meiosis: Four sperm versus one egg </b></span></div>
<div class="MsoNormal">
In a male, meiosis creates four sperm, because the chances
are very slim that any one will reach the egg. In females, as much of the
cytoplasm as possible is reserved for one daughter cell at each cell division.
Meiosis II in a female is not complete until the egg is fertilized. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: small;"><b>How Cell Reproduction is
Regulated</b></span></div>
<div class="MsoNormal">
Not all cells in the body divide at the same rate. There are
some cells that stop dividing after adolescence and some that divide rapidly
throughout your life span. And
then, there are variable speeds at which they divide. There are internal
controls inside the cell and there are also checkpoints along the way that may
stop cell division if that cell is not ready. Another factor that may stop cell
division comes from without the cell. For example, if certain nutrients and/or
hormones are not available. And finally, other cells can also affect the cycle.
When they come into contact with one another, they release a substance that
stops cell division. This is an example of a negative feedback system working
to control tissue growth and organ size.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: small;"><b>Environmental Factors
Influence Cell Differentiation</b></span></div>
<div class="MsoNormal">
How is it, that even though every cell starts out with the
same DNA, there are many different kinds of specialized cells? Differentiation
is the process that develops a cell differently than the parent or sister
cell. This happens because
different genes are expressed.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b>Differentiation during early development</b></span></div>
<div class="MsoNormal">
It is the environment surrounding the cells that affects
what genes are developed in each cell. For example, some may be exposed to more
O2 content or a different pH. So,
what is happening internally is very much mimicked by what happens externally
as a child develops. Our surroundings or environment have a great deal to do
with how we develop psychologically, emotionally and socially. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b>Differentiation later in development</b></span></div>
<div class="MsoNormal">
In later development there are two factors that influence
differentiation, one is it’s environment and two is the history of the cells
that came before it. For instance, a cell that begins to be a muscle cell also
differentiates into either smooth, cardiac or skeletal muscle. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: small;"><b>Cloning an Organism
Requires an Undifferentiated Cell</b></span></div>
<div class="MsoNormal">
There are two techniques for accomplishing reproductive
cloning: embryo splitting and somatic cell nuclear transfer.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b>Embryo splitting: producing identical offspring</b></span></div>
<div class="MsoNormal">
Cloning by embryo splitting produces eight identical clones
to each other, but not exact copies of the parent. This is done in vitro (a
fertilized egg is implanted into a surrogate mother). </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b>Somatic cell nuclear transfer: cloning an adult</b></span></div>
<div class="MsoNormal">
A somatic cell is any cell in your body except a sex cell
and it has a full set of DNA. This process develops an identical clone to the
parent. Dolly the sheep was the
first successful result of this process. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: small;"><b>Therapeutic Cloning:
Creating Tissues and Organs</b></span></div>
<div class="MsoNormal">
Therapeutic cloning is for the purpose of treating disease
in humans with the ultimate goal being to create cells, tissues and possibly
even whole organs for patients. However, as it becomes more successful, it
brings up the issues of human cloning. It is a social and ethical debate that
must have answers before we get there. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="color: red; font-size: large;"><b>Cancer: Uncontrolled Cell
Division and Differentiation</b></span><br />
<div style="color: #0b5394;">
<span style="font-size: small;"><b><a href="http://www.youtube.com/watch?v=IeUANxFVXKc" target="_blank">Normal Versus Cancer Cell Division</a> Video</b></span></div>
</div>
<div class="MsoNormal">
Cancer is an ugly word to all of us and one that is greatly
feared. Most of us have been touched by this disease in one way or another. One
way to mitigate this fear is to begin to understand what cancer is. In doing
so, we need to understand a couple of things about normal cell development:
One, normal cells have mechanisms that regulate the rate of cell division. It
is carefully controlled by an internal clock, hormones, and from nearby cells.
Two, normal cells, for the most part, remain in one place. One exception to
that being blood cells. </div>
<div class="MsoNormal">
<br /></div>
<table align="center" cellpadding="0" cellspacing="0" class="tr-caption-container" style="margin-left: auto; margin-right: auto; text-align: center;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhp2pG4GoNJjCUJfxG2gMqH-KuBc12ccyBSlVpq18-GfH1s0IqVnmNrEBjJN7Zm1NwR-zvO6KkhIL4dtf-SRXzYkShaecXjF-v4wY53Co8BqzQk71vUDsJh0qSFai2v14AO-1NKaiHp_RkU/s1600/tumor.jpg" imageanchor="1" style="margin-left: auto; margin-right: auto;"><img border="0" height="140" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhp2pG4GoNJjCUJfxG2gMqH-KuBc12ccyBSlVpq18-GfH1s0IqVnmNrEBjJN7Zm1NwR-zvO6KkhIL4dtf-SRXzYkShaecXjF-v4wY53Co8BqzQk71vUDsJh0qSFai2v14AO-1NKaiHp_RkU/s320/tumor.jpg" width="320" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Tumor / google.com / accessed 3/8/12</td></tr>
</tbody></table>
<div class="MsoNormal">
<span style="font-size: small;"><b>Tumors can be Benign or
Cancerous</b></span></div>
<div class="MsoNormal">
Sometimes normal cells increase their rate of division as
part of the their normal function, which is called hyperplasia. But when this
goes out of control, a mass forms. This is called a tumor or neoplasm. But not
all tumors are cancerous. Benign tumors are defined as a mass that remains in
one place and is well-defined. It
still has most of the structural features of the original cells and may be
surrounded by connective tissue. Benign tumors usually only threaten your
health if they become so large that they start to crowd out normal cells. Most
of the time, these tumors can be removed easily via surgery. Moles are
sometimes a form of a benign mass, which is why it is good to monitor them for
any changes, in case they start to turn cancerous.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: small;"><b>Cancerous Cells Lose
Control of their Functions and Structures</b></span></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjRoJJea-qwjH3li9UZ2A4hwyGf-YMedkz-2ZMZ5F9whf_iWgzROEtDkcVLvmXD3IBtGEQoOGRX2W215IhxnlHzmQl3FwFC6vRMGhZigTiWFoTsse9H20oOoCNDBRGvKtPItt2Vv934127E/s1600/lungcancercelldiv.jpg" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="153" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjRoJJea-qwjH3li9UZ2A4hwyGf-YMedkz-2ZMZ5F9whf_iWgzROEtDkcVLvmXD3IBtGEQoOGRX2W215IhxnlHzmQl3FwFC6vRMGhZigTiWFoTsse9H20oOoCNDBRGvKtPItt2Vv934127E/s200/lungcancercelldiv.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Lung Cancer Cell Division / bayer.com / accessed 3/8/12</td></tr>
</tbody></table>
<div class="MsoNormal">
In addition to rapidly increased cell division, cancerous
cells also lose structure and function. The nucleus may become larger and there
is less cytoplasm. This is called dysplasia. Dysplasia often is a sign of
precancerous cells forming. When some of the cells in a tumor start to lose any
semblance of structure, organization and regulatory control, it is defined as
cancer. In situ cancer remains in one place, and if caught early enough, can be
removed. If the cancer cells begin
to separate, then metastasis may result, spreading to other parts of the body.
They spread through the blood or lymph and begin to develop new colonies,
sometimes totally overrunning entire tissues, organs and organ systems. It
consumes everything just like a forest fire. One in three people in the U.S.
will experience cancer in their lifetime and one in four people will die from
it. It is the number two cause of death in the United States, second only to
heart disease. </div>
<div class="MsoNormal">
<br /></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgkOhOADU5R4ou4CH0gb0Fg-1075RScT-N-ZS_yaayXdRW9tPlWYxVabfNdpVikgID2HYKQjfHI2ObGbXrvO4m_3PEeSI9ywKb_-YOFtnV83V7KCjMoxO1NNO0_A22a2tsWdPQBt5SugXAw/s1600/MetastasisColonies.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="200" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgkOhOADU5R4ou4CH0gb0Fg-1075RScT-N-ZS_yaayXdRW9tPlWYxVabfNdpVikgID2HYKQjfHI2ObGbXrvO4m_3PEeSI9ywKb_-YOFtnV83V7KCjMoxO1NNO0_A22a2tsWdPQBt5SugXAw/s200/MetastasisColonies.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Metastasis Colonies / fmp-berlin.info.com / accessed 3/8/12</td></tr>
</tbody></table>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: small;"><b>How Cancer Develops</b></span></div>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b>Mutant forms of proto-oncogenes, tumor suppressor genes,
and mutator genes contribute to cancer</b></span></div>
<div class="MsoNormal">
There are three types of genes that have been identified
that help to control various cell activity. Proto-oncogenes promote cell
growth, differentiation, division or adhesion. Tumor suppressor genes normally
inhibit unchecked cell growth, division, differentiation or adhesion. And mutator
genes help in DNA repair during replication. If any of these particular genes
become damaged themselves, they mutate and a variety of cancers may begin to develop more readily.</div>
<div class="MsoNormal">
<br /></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiHoutUo1pOpE6rbNPqwFL9xmdm3voVAymuM1ck7zvy8XOIE9Wib_xUjm-aQBydFmKrmk_D-8IDr-Tc2jOr6Je7e-XV15PZ0Jxm5GkCG7hxPvPHqrGKMwIC7ZF88L3A9mDxZzZ54FF_YK-p/s1600/Airpollution.JPG" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="150" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiHoutUo1pOpE6rbNPqwFL9xmdm3voVAymuM1ck7zvy8XOIE9Wib_xUjm-aQBydFmKrmk_D-8IDr-Tc2jOr6Je7e-XV15PZ0Jxm5GkCG7hxPvPHqrGKMwIC7ZF88L3A9mDxZzZ54FF_YK-p/s200/Airpollution.JPG" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Air Pollution / toxipedia.org / accessed 3/8/12</td></tr>
</tbody></table>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b>A variety of factors can lead to cancer</b></span></div>
<div class="MsoNormal">
No single defect is enough to cause cancer. It is when
numerous factors are present, that allows cancer to form. Possibly the number
one factor is age. Cells begin to wear out and repair mechanisms begin to fail
more frequently. Factors that cause cancer, or carcinogens, are listed below.</div>
<div class="MsoNormal">
<br /></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj4viHLtTCsNFIr1NxL2aYfxtABY70dOvaDgnBtwpqiWYh8vT8Rc6H35o78SblHcXAHhhNE30AkWRHhhxZjGaKNp0-mAFOoRcQVGhLDCJhQWJhXUdoBk7DN8GB2y8yzhod2X7_1pMUR-vs5/s1600/sunburn.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="120" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj4viHLtTCsNFIr1NxL2aYfxtABY70dOvaDgnBtwpqiWYh8vT8Rc6H35o78SblHcXAHhhNE30AkWRHhhxZjGaKNp0-mAFOoRcQVGhLDCJhQWJhXUdoBk7DN8GB2y8yzhod2X7_1pMUR-vs5/s200/sunburn.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Sunburn / lifehacker.com / accessed 3/8/12</td></tr>
</tbody></table>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal">Viruses
and Bacteria</li>
<li class="MsoNormal">Chemicals
in the Environment</li>
<li class="MsoNormal">Tobacco</li>
<li class="MsoNormal">Radiation</li>
<li class="MsoNormal">Diet</li>
<li class="MsoNormal">Internal
Factors</li>
</ul>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
Tobacco accounts for over 30% off all cancer deaths. Diet
also may be up to 30%, rivaling tobacco. The radiation from sunlight causes up to
80% of all skin cancers, including melanoma. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b>The immune system plays an important role in cancer prevention</b></span></div>
<div class="MsoNormal">
Suppression of the immune system is involved in many
cancers. Some cancers can suppress the immune system, while others can disguise
themselves from attack by the immune system. Other factors that can suppress
the immune system are drugs, viruses (including HIV), states of anxiety,
stress, and depression, which allow cancers to develop more easily. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: small;"><b>Advances in Diagnosis
Enable Early Detection</b></span></div>
<div class="MsoNormal">
Early detection of cancer plays a key role in the success of
beating it. The sooner it can be treated, the less likely it is to metastasize.
Prompt treatment, in some cases, can cure it.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b>Tumor imaging: X-rays, PET, and MRI</b></span></div>
<div class="MsoNormal">
X-rays are the traditional way of detecting tumors. But
advances in technology can now detect changes that traditional x-rays may miss
by using either the PET, positron-emission tomography, or MRI, magnetic
resonance imaging.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b>Genetic testing can identify mutated genes</b></span></div>
<div class="MsoNormal">
Hundreds of genes and their mutated counterparts have been
identified and tests are being devised to detect them. However, if a mutated
gene is found, this is just a risk factor, not a be-all, end-all for developing
cancer. And there may not be a cure, either. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b>Enzyme tests may detect cancer markers</b></span></div>
<div class="MsoNormal">
Telomerase is an enzyme that is rarely found in normal
cells, but is almost always present in cancer cells. This and other cancer
markers are being explored for early detection of cancer. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: small;"><b>Cancer Treatments</b></span></div>
<div class="MsoNormal">
While some cancers are more treatable than others, when
detected early enough, current treatments cure approximately 50% of all cancer
cases.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b>Conventional cancer treatments: surgery, radiation, and chemotherapy</b></span></div>
<div class="MsoNormal">
Surgery, Radiation and Chemotherapy are the traditional
forms of treating cancer, many times combining two or more of these. The
drawbacks being that surgery may miss some metastasized cells, allowing the
cancer to reappear later. And radiation can also miss these as well as destroy
healthy cells in the process of destroying cancerous cells. Chemotherapy is the
administration of chemicals and addresses some of the limitations of surgery
and radiation. However, it can damage normal cells, especially in the bone
marrow and digestive tract. Many times the tumors become resistant to the
chemical, just like bacteria to antibiotics. Combinations of these therapies
sometimes work best.</div>
<div class="MsoNormal">
<br /></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgOkXMmAQHBItNqytVn8p6rV2bAhQUHaizVEBlCmbUOqd-o7jGedXkZhM1ntCbfkfUsNMDrlvuhDNs70_Mvw0Advx8xQaQ8M8mQkjBSLVTDfaaRJHyNu4TuFxpyTJNWbG1xSGs7zPDe8vsk/s1600/treatcancer.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="161" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgOkXMmAQHBItNqytVn8p6rV2bAhQUHaizVEBlCmbUOqd-o7jGedXkZhM1ntCbfkfUsNMDrlvuhDNs70_Mvw0Advx8xQaQ8M8mQkjBSLVTDfaaRJHyNu4TuFxpyTJNWbG1xSGs7zPDe8vsk/s200/treatcancer.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Treatment of Cancer / nanobiotechnews.com / accessed 3/8/12</td></tr>
</tbody></table>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b>Magnetism and photodynamic therapy target malignant cells</b></span></div>
<div class="MsoNormal">
Researching have been developing techniques to target
malignant cells more precisely and avoid killing off normal healthy cells. Two
of the more promising techniques are magnetism and photodynamic therapy.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
Magnetism is currently in clinical trials with liver cancer
patients. In this technique, a powerful magnet is positioned at the tumor site.
Tiny metallic beads, coated with a chemotherapy drug, are injected into the
bloodstream. The magnet pulls the beads into the tumor and the chemo drug then
kills the cancer.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
Photodynamic therapy has been approved and in use for
several years to treat tumors of the esophagus and lungs. And it looks
promising for other cancers as well, as they refine laser techniques. In this
therapy, the patient takes a light-sensitive drug that is drawn into the cancer
cells. Then laser light, at a particular frequency, is focused on the tumor.
This triggers a series of chemical reactions that kill malignant cells.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b>Immunotherapy promotes immune response </b></span></div>
<div class="MsoNormal">
In immunotherapy, they attempt to boost the responsiveness
of the immune system so that it may fight cancer more effectively. Research has
been focused on finding specific antigen molecules that are present in cancer
cells, but not normal cells. Then they are used to produce antibodies that
target cancer. In one step further, researchers are trying to attach
radioactive molecules or chemotherapy drugs to the antibodies to deliver treatment
to the cancer cells and sparing the normal cells. They are also testing
vaccines made from a patient’s own cancer cells. Once injected, the modified
cancer cells seem to stimulate the person’s immune system to combat the
abnormal cells.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b>“Starving” cancer by inhibiting angiogenesis</b></span></div>
<div class="MsoNormal">
Because tumors grow and divide rapidly, they need a great
deal of energy. Something within the tumor is actually promoting angiogenesis
or the growth of new blood vessels, for energy. There are proteins that promote
angiogenesis and proteins that inhibit it. So the theory is to starve the tumor
by limiting its blood supply. Several anti-angiogenic drugs are now on the
market. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b>Molecular treatments target defective genes</b></span></div>
<div class="MsoNormal">
Research is being done for gene therapy, attempting to inactivate
specific genes, or the proteins they encode, to slow cell division. Gene
therapy would either repair or replace defective genes with normal genes. One
key target is the p53 tumor suppressor gene, that when defective, contributes
to numerous cancers.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: small;"><b>The 10 Most Common Cancers
</b></span></div>
<div class="MsoNormal">
The following is a list of the 10 most common cancers.</div>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal"><b style="color: purple;">Skin
cancer</b><span style="font-weight: normal;"><span style="color: purple;"> </span>– Look for changes in your
skin</span></li>
<li class="MsoNormal"><b style="color: purple;">Lung
cancer</b><span style="font-weight: normal;"><span style="color: purple;"> </span> - Smoking is leading risk factor</span></li>
<li class="MsoNormal"><b style="color: purple;">Breast
cancer</b><span style="font-weight: normal;"><span style="color: purple;"> </span>– Early detection pays off</span></li>
<li class="MsoNormal"><b style="color: purple;">Prostate
cancer</b><span style="font-weight: normal;"> - Most common after age 50</span></li>
<li class="MsoNormal"><b style="color: purple;">Cancers
of colon and rectum</b><span style="font-weight: normal;"> – Tests can
detect them early</span></li>
<li class="MsoNormal"><b style="color: purple;">Lymphoma</b><span style="font-weight: normal;"> – Cancers of lymphoid tissues</span></li>
<li class="MsoNormal"><b style="color: purple;">Urinary
bladder cancer</b><span style="font-weight: normal;"><span style="color: purple;"> </span>– Surgery is often
successful if done early</span></li>
<li class="MsoNormal"><b style="color: purple;">Kidney
cancer</b><span style="font-weight: normal;"><span style="color: purple;"> </span>– Detected during examination
for a renal-related problem</span></li>
<li class="MsoNormal"><b style="color: purple;">Cancer
of the uterus</b><span style="font-weight: normal;"> – Unusual uterine
bleeding is major symptom</span></li>
<li class="MsoNormal"><b style="color: purple;">Leukemia</b><span style="font-weight: normal;"> – Chemotherapy is often effective</span></li>
</ul>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
Each of these has its own risk factors, warning signs,
methods of detection, treatments, and survival rates. The most frequent cancers
are skin, lung, colon and rectum cancers. Prostate cancer is most common in men
and breast cancer in women. The most deadly cancers are lung, colon, rectum,
and breast cancers. </div>
<div class="MsoNormal">
<br /></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjj_-MyVfzIm0Hdw4F-y2J6LiCUjM1Jf5XEiBPnCbS9zs3coYPVXc2rhxkIWZQbEMyvR8JREHJBijNElMAr4bg2biaFoRXDEo6gG2O87pGgaybtcnJp-uI_qs6USBcdvqOFwi0XxNQYJAvS/s1600/healthyfood.jpg" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="200" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjj_-MyVfzIm0Hdw4F-y2J6LiCUjM1Jf5XEiBPnCbS9zs3coYPVXc2rhxkIWZQbEMyvR8JREHJBijNElMAr4bg2biaFoRXDEo6gG2O87pGgaybtcnJp-uI_qs6USBcdvqOFwi0XxNQYJAvS/s200/healthyfood.jpg" width="166" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Healthy Food / i.istockimg.com / accessed 3/8/12</td></tr>
</tbody></table>
<div class="MsoNormal">
<span style="font-size: small;"><b>Most Cancers Can Be
Prevented</b></span></div>
<div class="MsoNormal">
Despite heritable cancers, most incidences of cancer are
thought to be preventable. (And early detection plays a vital role in
successfully treating heritable cancers.) At least 60% of all cancer cases,
other than non-melanoma skin cancers, are thought to be caused by only two
factors – smoking and poor diet. Skin cancers could be prevented by limiting
our exposure to the sun. Public
education is vital to decreasing the death rate of cancer. The following are
tips to reducing your own risk:</div>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal">Know
your family history.</li>
<li class="MsoNormal">Know
your own body.</li>
<li class="MsoNormal">Get
regular medical screenings for cancer.</li>
<li class="MsoNormal">Avoid
direct sunlight between 10 am - 4 pm. (where sunscreen and a broad-brimmed
hat).</li>
<li class="MsoNormal">Watch
your diet and your weight.</li>
<li class="MsoNormal">Don’t
smoke. (And limit your exposure to second-hand smoke).</li>
<li class="MsoNormal">If you
consume alcohol, drink in moderation.</li>
<li class="MsoNormal">Stay
informed. </li>
</ul>
<br />
<style>
@font-face {
font-family: "Times New Roman";
}@font-face {
font-family: "Courier New";
}@font-face {
font-family: "Wingdings";
}p.MsoNormal, li.MsoNormal, div.MsoNormal { margin: 0in 0in 0.0001pt; font-size: 12pt; font-family: "Times New Roman"; }table.MsoNormalTable { font-size: 10pt; font-family: "Times New Roman"; }div.Section1 { page: Section1; }ol { margin-bottom: 0in; }ul { margin-bottom: 0in; }
</style>
<br />
<div class="MsoNormal" style="color: red;">
<span style="font-size: large;"><b>Genetics and Inheritance</b></span></div>
<div class="MsoNormal">
Genetics is the study of genes and their transmission from
one generation to the next. The
development of a human being is contained in the DNA within the nucleus of the
fertilized egg. This information is expressed in the form of genes, which are
DNA sequencing codes for one or more proteins. Each of us inherits one complete
set of genes from both mother and father. Though each of has a complete set,
they vary from individual to individual, which accounts for our differences.
Genes affect our traits, features, health and possibly even our thoughts and
actions. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: small;"><b>Your Genotype is the Genetic Basis of your Phenotype</b></span></div>
<div class="MsoNormal">
We each possess 23 pairs of chromosomes, 22 are autosomes,
and one is a pair of sex chromosomes. Humans inherit one of each pair, giving
us two copies of each gene. But when you look closer, there are small
differences in the DNA sequence. These differences produce alleles, which are
alternative versions of the gene.
Your complete set of alleles is your genotype. Your genotype influences
you phenotype, which is the observable physical and functional traits that
characterize you. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: small;"><b>Genetic Inheritance Follows
Certain Patterns </b></span></div>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b>Punnett square analysis predicts patterns of inheritance</b></span></div>
<div class="MsoNormal">
People with the same two alleles of a gene (AA or aa) are
homozygous. And people with different alleles (Aa) are heterozygous. A Punnett
square helps to provide possible combinations of patterns of inheritance for
that particular genotype. You place the male gametes on one axis and the female
on the other axis. Then you place the possible combinations in each square. But
keep in mind that each parent will only donate one of each chromosome. </div>
<div class="MsoNormal">
<br /></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEh2O3R3OJzTFuA6LSdMjLWmZnc5Oi8k8kZkQL_f8Uc1o0NPWFhGJJ4tlaU3GLYIwrVaxt_cJaZVMAqm5Aw12Viu07KHTwxytOMv4_IRzwHttuwmBgk1yChQxYESFzrXygvm1znEH1FYMmXP/s1600/Mendelflowers.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="197" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEh2O3R3OJzTFuA6LSdMjLWmZnc5Oi8k8kZkQL_f8Uc1o0NPWFhGJJ4tlaU3GLYIwrVaxt_cJaZVMAqm5Aw12Viu07KHTwxytOMv4_IRzwHttuwmBgk1yChQxYESFzrXygvm1znEH1FYMmXP/s200/Mendelflowers.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Mendels Flowers / upload.wikimedia.org / accessed 3/8/12</td></tr>
</tbody></table>
<div class="MsoNormal" style="color: purple;">
<br />
<br />
<br />
<span style="font-size: small;"><b>Mendel established the basic principles of genetics</b></span></div>
<div class="MsoNormal">
Gregory Mendel was a university-educated Austrian monk who
lived in the 1850’s. He specialized in natural history. Over a seven year
period, he studied and experimented
with garden peas, noting that there were discrete factors of heredity
that unite during fertilization and then separate again with sperm and egg. The
law of segregation is now known as Mendel’s first rule of inheritance: when
gametes are formed in the parents, the alleles separate from each other so that
only one gamete gets only one allele of each gene.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b>Dominant alleles are expressed over recessive alleles</b></span></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhH6YG3VCX6uUfchgJR0bX_feMZrwZFza14yJbw1td653E-I_GtfvY9DOghsADh60m-Te4au6Cheid4jze0u6CWq0xts651kNXgN4TFm_ASS24BS7LvGEfnmPE6zYunEFclM8WLaAsBTK5X/s1600/dominantalleletrait.jpg" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="200" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhH6YG3VCX6uUfchgJR0bX_feMZrwZFza14yJbw1td653E-I_GtfvY9DOghsADh60m-Te4au6Cheid4jze0u6CWq0xts651kNXgN4TFm_ASS24BS7LvGEfnmPE6zYunEFclM8WLaAsBTK5X/s200/dominantalleletrait.jpg" width="132" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Dominant Allele Trait / dreamstime.com / accessed 3/8/12</td></tr>
</tbody></table>
<div class="MsoNormal">
A dominant allele is expressed as (A) and a recessive allele
as (a). Mendel noted that some peas skipped a generation in regards to color.
He determined that some colors had dominance over others. In this case, yellow
was dominant and green, recessive.
This holds true for humans as well. There are some recessive alleles,
that when present, result in the absence of a functionally important protein.
An example of this is cystic fibrosis, which afflicts only homozygous recessive
people. The term dominant only refers to how an allele behaves in combination
with a recessive allele in a heterozygote.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b>Two-trait crosses: independent assortment of genes for different traits</b></span></div>
<div class="MsoNormal">
Mendel formulated his law of independent assortment when
performing a two-trait crossing. This states that the alleles of different
genes are distributed to egg and sperm cells independently of each other during
meiosis. But he was only partially right. Only genes located on different
chromosomes always assort independently. Alleles located on the same chromosome
(linked alleles), may or may not be inherited together.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: small;"><b>Other Dominance Patterns</b></span></div>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b>Incomplete dominance: heterozygotes have an intermediate phenotype</b></span></div>
<div class="MsoNormal">
In incomplete dominance, the alleles do not follow the
dominant/recessive pattern. Instead, the heterozygous genotype results in a
phenotype that is intermediate between the two homozygous phenotypes. An example of this is the trait in
Caucasians of having either straight, wavy, or curly hair. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b>Codominance: both gene products are equally expressed</b></span></div>
<div class="MsoNormal">
In codominance the products of the two alleles are expressed
equally. One example of this is
blood type. There are 3 alleles for this gene: O, A and B. O is recessive and
when combined with A or B, the person will have either A or B. But But the A
and B alleles are codominant. If a person is heterozygous with an A and a B
allele, they will have AB antigens in their red blood cells. Sickle-cell anemia
is another example.</div>
<div class="MsoNormal">
<br /></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEilFc5SiSWEDN_4tB7syl9mXGnb5H11m83geHRU8CwHRSFmI7QrnRC1oZYT0Sl8MZizfyN3bcXZOBxtnikyt4zYAHxdFVLHJb2aBFsaVF2wC5aZ-jhoe_zyh8bE53WKh1b-xqP9A6PaBXMx/s1600/polygenicinheritance.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="120" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEilFc5SiSWEDN_4tB7syl9mXGnb5H11m83geHRU8CwHRSFmI7QrnRC1oZYT0Sl8MZizfyN3bcXZOBxtnikyt4zYAHxdFVLHJb2aBFsaVF2wC5aZ-jhoe_zyh8bE53WKh1b-xqP9A6PaBXMx/s200/polygenicinheritance.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Polygenic Inheritance / static.guin.co.ak / accessed 3/8/12</td></tr>
</tbody></table>
<div class="MsoNormal">
<br />
<br />
<span style="font-size: small;"><b>Other Factors Influence
Inheritance Patterns and Phenotype</b></span></div>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b>Polygenic inheritance: phenotype is influenced by many genes</b></span></div>
<div class="MsoNormal">
Polygenic inheritance is when phenotypic traits depend on
numerous genes, all acting simultaneously. For example, eye color is controlled by at least three
genes, with a range of color phenotypes from nearly black to light blue. Other
examples include height, body size, and shape. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b>Both genotype and the environment affect phenotype</b></span></div>
<div class="MsoNormal">
Phenotype is influenced in part by our genotype and in part
by our environment. An example being our body size and height and the effect of
diet. In developed countries especially, there is a trend towards increased
height and weight in certain populations. Sometimes those changes occur within
one generation, which is too short a time period to be due to the gene pool. It
is mainly due to improvements in diet and nutrition, especially in the
young. Another example is our
inheritable risk factors (genes). If
we know that something is a risk, say heart disease, by dieting, exercise, and
reducing environmental risks, you may eliminate or at least, much improve your
chances of never developing thos problem.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b>Linked alleles may or may not be inherited together</b></span></div>
<div class="MsoNormal">
Many alleles for different traits are sometimes inherited
together because they are physically joined on the same chromosome. These are linked alleles and the closer
they are on the chromosome, the more likely you are to inherit both
traits. </div>
<div class="MsoNormal">
<br /></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhn-ovH4GQTty1Ci6KWp4JiauzMcpbeXx44TX2fQIiJrnp3ILcrsIJ72WfjkzWoasV4fSGxmzN1Oq2sUsvG8MrJfJhyphenhyphen4HahKUeVu0Y0A2RW-9LBZOEndqOTAq-x8i4ALHuNxvvv6sz9ot7c/s1600/Humankaryotype.jpg" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="149" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhn-ovH4GQTty1Ci6KWp4JiauzMcpbeXx44TX2fQIiJrnp3ILcrsIJ72WfjkzWoasV4fSGxmzN1Oq2sUsvG8MrJfJhyphenhyphen4HahKUeVu0Y0A2RW-9LBZOEndqOTAq-x8i4ALHuNxvvv6sz9ot7c/s200/Humankaryotype.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Human Karyotype / sciencephoto.com / accessed 3/8/12</td></tr>
</tbody></table>
<div class="MsoNormal">
<span style="font-size: small;"><b>Sex-Linked Inheritance: X
and Y Chromosomes Carry Different Genes</b></span></div>
<div class="MsoNormal">
A karyotype is a composite display of all 23 chromosomes of
an organism. They are only identifiable right before cell division. Every pair
is matched up (autosomes), except for the last pair, which are the sex
chromosomes, X and Y. Females have two XX chromosomes and males have an X and a
Y chromosome. It is the male sperm that dictates the sex of the offspring.
Females will of course donate an X, whereas males can either donate an X or a Y
– so, a Y will determine a male and an X a female.</div>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b><br /></b></span><br />
<span style="font-size: small;"><b><br /></b></span><br />
<span style="font-size: small;"><b> Sex-linked inheritance depends on genes located on sex chromosomes</b></span></div>
<div class="MsoNormal">
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj1IhhjmD3uDeRADKj7Z33ANGxbH_x_lPOonDT2SyMKAwJDSeoUQjY-8bggZi8j0v2I_vVJ07vm73WjnxLDIbCDpPlMnVgaKHFjdZqCgMsGhWLJvem-LIBU7gYqdXFGTAUK5qZDqsXrdZ7a/s1600/Xchromosomes.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="181" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj1IhhjmD3uDeRADKj7Z33ANGxbH_x_lPOonDT2SyMKAwJDSeoUQjY-8bggZi8j0v2I_vVJ07vm73WjnxLDIbCDpPlMnVgaKHFjdZqCgMsGhWLJvem-LIBU7gYqdXFGTAUK5qZDqsXrdZ7a/s200/Xchromosomes.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">X Chromosomes / cdn.physorg.com / accessed 3/8/12</td></tr>
</tbody></table>
Sex-linked inheritance is X-linked if the gene is only
located on the X chromosome and Y-linked if it is only on the Y
chromosome. Genes on the Y chromosome
are mainly related to “maleness”. Meaning the male sex organs, production of
sperm, and the development of secondary sex characteristics. But genes on the X
chromosome are numerous and not related to sex determination. In females,
because they have two X chromosomes, there is a backup if one is abnormal, just
like the autosomes. But in males, they only have one X and because of this,
they are more susceptible to diseases associated with recessive alleles on the
sex chromosomes. The best example of an X-linked disease is hemophilia.
Muscular dystrophy and red-green color blindness are two more examples.</div>
<div class="MsoNormal">
</div>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b><br /></b></span></div>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b> Sex-influenced traits are affected by actions of sex genes</b></span></div>
<div class="MsoNormal">
An example of sex-influenced traits that are affected by the
actions of genes on the sex chromosome is baldness. This allele is recessive in
females and so much rarer. But in males, with the same gene, their hair loss is
significant. This is due to testosterone, which stimulates this allele,
changing it from recessive to dominant.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: small;"><b>Chromosomes may be Altered
in Number or Structure </b></span></div>
<div class="MsoNormal">
Nondisjunction is the failure of homologous chromosomes or
sister chromatids to separate properly. If this happens during mitosis, it is
not as serious as when it happens during meiosis. During meiosis, if this goes awry, it has the potential to
alter the development of an entire organism. Most of the time, this is taken
care of before we even know there was a problem. The embryos do not survive.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b>Down syndrome: three copies of chromosome 21</b></span></div>
<div class="MsoNormal">
Of the embryos that do survive the alteration of autosomal
chromosome numbers, the most common is Down syndrome. There are three types of
Down syndrome, but the most common is caused by having three copies of
chromosome 21 (trisomy 21). Age of the mother is a determining factor in the
risk of having a child with Down syndrome. Under age 30, the risk factor is one
in every 1300. By age 40, it jumps to one in 100 and by age 45, one in 25. And
recent studies show that paternal age may also play a part if both parents are
over age 35.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b>Alterations of the number of sex chromosomes </b></span></div>
<div class="MsoNormal">
There are a variety of combinations that nondisjunction of
the sex chromosomes can produce. The following are the most common:</div>
<div class="MsoNormal">
<br /></div>
<ul style="margin-top: 0in;" type="disc">
<li class="MsoNormal">XYY –
Jacob syndrome.</li>
<li class="MsoNormal">XXY –
Klinefelter syndrome.</li>
<li class="MsoNormal">XXX –
Trisomy-X syndrome.</li>
<li class="MsoNormal">XO –
Turner syndrome.</li>
</ul>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b>Deletions and translocations alter chromosome structure</b></span></div>
<div class="MsoNormal">
Deletions occur when a piece of chromosome breaks off and is
lost. Most of the time, the lose of a gene kills the sperm, egg, or embryo. But
on rare occasions, there is a live birth. An example is cri-du-chat syndrome.
These babies are usually mentally and physically retarded, and have kitten-like
cry’s due to a small larynx. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
When a piece of chromosome breaks away and reattaches to
another site it is called translocation. Translocation can have a subtle change
in gene expression and may affect their ability to function. This can increase
the risk of certain cancers, including one type of leukemia.</div>
<div class="MsoNormal">
<br /></div>
<table align="center" cellpadding="0" cellspacing="0" class="tr-caption-container" style="margin-left: auto; margin-right: auto; text-align: center;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhT0WcxszC_SOb4P1S7fg1P3dkZu8Yy4Oz7EmR4qXX0lcY6CBN8gunKqft1ZnXbRQsC0-j6yHLyefzQUMfeKl_eztvktuNB9SFJ8vKPombGWNk5sa0OHA1X-E8nLVYEEDhGnieqtishd1cK/s1600/recessivealleles.jpg" imageanchor="1" style="margin-left: auto; margin-right: auto;"><img border="0" height="236" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhT0WcxszC_SOb4P1S7fg1P3dkZu8Yy4Oz7EmR4qXX0lcY6CBN8gunKqft1ZnXbRQsC0-j6yHLyefzQUMfeKl_eztvktuNB9SFJ8vKPombGWNk5sa0OHA1X-E8nLVYEEDhGnieqtishd1cK/s400/recessivealleles.jpg" width="400" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Recessive Alleles / junglemagazine.com/ accessed 3/8/12</td></tr>
</tbody></table>
<div class="MsoNormal">
<span style="font-size: small;"><b>Many Inherited Genetic
Disorders Involve Recessive Alleles</b></span></div>
<div class="MsoNormal">
Most genetic disorders are caused by two defective,
recessive alleles. If you only inherit one, you can pass it to your children,
but do not have the disease yourself because the good allele is dominant. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b>Phenylketonuria is caused by a missing enzyme</b></span></div>
<div class="MsoNormal">
PKU occurs one in every 12,000 births in Caucasians. It is
caused by mutation of the gene on chromosome 1. It can lead to toxic levels of
phenylpyruvic acid which can cause mental retardation, slow growth rate, and
early death. Because of the serious mental retardation factor, all states now
require that newborns be tested for PKU (the Guthrie test). It can be treated
but requires limiting diet intake of phenylalanine, which is in most protein.
Not an easy task and expensive to boot.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b>Tay-Sachs disease leads to brain dysfunction</b></span></div>
<div class="MsoNormal">
Another enzyme deficiency is Tay-Sachs disease. This is
caused by a recessive gene on chromosome 15. Tay-Sachs is rare in the general
population. But it is fairly common among Ashkenazi Jews of Central European
descent. Approximately one in 3500 have this disease. It does not manifest at
first, but by 4-8 months, motor and brain function begin to decline. They
gradually develop seizures, become blind and paralyzed and usually die by age 3
or 4. At this time, there is no known cure or treatment. Tests are available to
determine if either parent is a carrier. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b>Huntington disease is caused by a dominant-lethal allele </b></span></div>
<div class="MsoNormal">
<span style="font-size: small;">Dominant-lethal alleles are not common and tend to eliminate
the</span>mselves from the population. Huntington’s disease is unusual. It remains in
the population because it’s symptoms do not appear until your 30’s. By this
point, you have already had children and passed along the disease. It is a
progressive nerve degeneration that leads to physical and mental disability and
death. There is a test for the HD
allele. This is one disease that would benefit greatly from genetic testing. </div>
<div class="MsoNormal">
<br /></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhth45gjXJeb4NINZD_Bz5HuBabdAtNafnoOyo2l1eZSLYOUwLTFFqADzGxSmSKhCXheQ0gKmx3-mOz8ppzrfNrtnthCwFVqXgt1EMwHvSYkt08R-XbJ7L5fQIz6V_pjYy-CEK3kU77sa0f/s1600/humanbehaviors.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="200" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhth45gjXJeb4NINZD_Bz5HuBabdAtNafnoOyo2l1eZSLYOUwLTFFqADzGxSmSKhCXheQ0gKmx3-mOz8ppzrfNrtnthCwFVqXgt1EMwHvSYkt08R-XbJ7L5fQIz6V_pjYy-CEK3kU77sa0f/s200/humanbehaviors.jpg" width="166" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Human Behaviors / socialwork.vcu.edu / accessed 3/8/12</td></tr>
</tbody></table>
<div class="MsoNormal">
<span style="font-size: small;"><b>Genes Code for Proteins,
Not for Specific Behaviors </b></span></div>
<div class="MsoNormal">
There has been some debate as to whether or not genes cause
depression, happiness, etc… The truth of the matter is that genes code for
specific proteins. They may influence patterns of behavior. For instance,
proteins may act as a hormone and hormones can affect your emotions. However,
they do not cause specific behaviors.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<style>
@font-face {
font-family: "Times New Roman";
}p.MsoNormal, li.MsoNormal, div.MsoNormal { margin: 0in 0in 0.0001pt; font-size: 12pt; font-family: "Times New Roman"; }table.MsoNormalTable { font-size: 10pt; font-family: "Times New Roman"; }div.Section1 { page: Section1; }ol { margin-bottom: 0in; }ul { margin-bottom: 0in; }
</style>
</div>
<table align="center" cellpadding="0" cellspacing="0" class="tr-caption-container" style="margin-left: auto; margin-right: auto; text-align: center;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj2LP0FHVQp4j8VmD44ukxg8HF6i4UugCP7ioM8RJSDP3XI98IUk0HxS5WshUeTAwpAxo6X5N_SgNUEoxpELqpiDUUFbMKEVEcul6ETycbi3Phe634pgTc5yv1uF3Pfoxm8PgNsMsg8rJDF/s1600/genomedna.jpg" imageanchor="1" style="margin-left: auto; margin-right: auto;"><img border="0" height="303" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj2LP0FHVQp4j8VmD44ukxg8HF6i4UugCP7ioM8RJSDP3XI98IUk0HxS5WshUeTAwpAxo6X5N_SgNUEoxpELqpiDUUFbMKEVEcul6ETycbi3Phe634pgTc5yv1uF3Pfoxm8PgNsMsg8rJDF/s400/genomedna.jpg" width="400" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Genome DNA / ramshrestha.wordpress.com / accessed 3/8/12</td><td class="tr-caption" style="text-align: center;"><br /></td></tr>
</tbody></table>
<div class="MsoNormal" style="color: red;">
<br />
<span style="font-size: large;"><b>DNA Technology and Genetic
Engineering</b></span></div>
<div class="MsoNormal">
Recombinant DNA technology is a fairly new field of
biotechnology, or the technology application of biological knowledge for human
purposes. We can now take DNA apart, analyze it and reconstitute it, which
produces molecules that have never existed before. This process is called
genetic engineering. Genetic
engineering is still in its infancy, but has incredible potential. But with
that said, it also holds great risks. We need to have a better understanding of
how it all works, in order to make better judgments in regards to how it should
be applied. To read more about the genome project, click here: <a href="http://www.genome.gov/" target="_blank">http://www.genome.gov/</a></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: small;"><b>DNA Sequencing Reveals
Structure of DNA</b></span></div>
<div class="MsoNormal">
DNA sequencing involves synthesis of a new strand of DNA to
a single strand and then sequencing that strand. They add four nucleotides and then DNA polymerase (an
enzyme) to the mixture, which begins synthesis. Then gel electrophoresis is implemented which creates an
electrical field that causes the DNA to migrate through. It is after this
process that sequence of DNA is calculated.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: small;"><b>DNA can be Cloned in the
Laboratory</b></span></div>
<div class="MsoNormal">
Because we have now learned enough about DNA to be able to
manipulate it, we now have the ability to develop organisms that have never
existed as well as modify defective human genes.</div>
<div class="MsoNormal">
<br /></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj8vs6oMSrwbWNHUmI7Acfu2hXUwEsmWz0Ow8vMxGgYKymScjHfgIyx0CYQLVc72ds2-K3dE6FoRHpZvUS299ZXb6a9tDbDVQsICDgP0obzLs54vkfPvDdJ2d4mM7AM3E9NLkYQ2iSoydxP/s1600/recombinantdna.jpg" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="160" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj8vs6oMSrwbWNHUmI7Acfu2hXUwEsmWz0Ow8vMxGgYKymScjHfgIyx0CYQLVc72ds2-K3dE6FoRHpZvUS299ZXb6a9tDbDVQsICDgP0obzLs54vkfPvDdJ2d4mM7AM3E9NLkYQ2iSoydxP/s200/recombinantdna.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Recombinant DNA / nanotechweb.org / </td><td class="tr-caption" style="text-align: center;">accessed 3/8/12</td></tr>
</tbody></table>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b>Recombinant DNA technology: isolating and cloning genes</b></span></div>
<div class="MsoNormal">
The goal of recombinant DNA technology is to transfer pieces
of DNA and the genes it contains, from one organism to another. It is commonly used to produce protein
products from bacteria. This
process uses restriction enzymes, DNA ligases, plasmids, and bacteria. The
process for cloning a gene or a protein product of a gene is listed below.</div>
<div class="MsoNormal">
</div>
<ol start="1" style="margin-top: 0in;" type="1">
<li class="MsoNormal">Isolate
DNA form bacterial and human cells.</li>
<li class="MsoNormal">Cut
both DNAs with the same restriction enzyme.</li>
<li class="MsoNormal">DNAs
are mixed. Human fragments line up with plasmid by base pairing of exposed
single-strand regions.</li>
<li class="MsoNormal">DNA
ligase is added to connect human and plasmid DNA together.</li>
<li class="MsoNormal">Plasmids
are absorbed by bacteria.</li>
<li class="MsoNormal">Bacteria
containing the recombinant plasmids of interest are selected and cloned.</li>
</ol>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b>Cloning DNA fragments: the polymerase chain reaction</b></span></div>
<div class="MsoNormal">
Polymerase chain reaction (PCR) is a technique used to make
millions of copies of a small fragment of DNA quickly. But it does not work for
cloning whole genes or the proteins they produce because they lack the
regulatory genes and proteins that are required to activate the genes.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b>Identifying the source of DNA: DNA fingerprinting</b></span></div>
<div class="MsoNormal">
Identifying the source of a fragment of DNA after it has
been copied or cloned is termed DNA fingerprinting. We use this technique to
identify criminals, unknown deceased individuals, paternity, and tracing of
ancestral relationships. Law enforcement has use this technique to trace
illegal trade of endangered live animals, animal meat, and ivory. In
evolutionary studies it has been used to establish relationships between
fossils. And in biology, it is used to study mating relationships between
animals.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: small;"><b>Genetic Engineering
Creates Transgenic Organisms</b></span></div>
<div class="MsoNormal">
Transgenic organisms are organisms that have been
genetically engineered. They have one or more foreign genes from a different
species. This has created a whole new field in science.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b>Transgenic bacteria have many uses </b></span></div>
<div class="MsoNormal">
One of the first applications used was the production of
hormones from bacteria, as well as a few nonhormone proteins. We produce
insulin now with this process as well as tissue plasminogen activator (tPA) and
human blood clotting factor VIII. Bacteria is also used to produce vaccines,
enzymes, citric acid and ethanol, and producing drugs for human use. We also use
transgenic bacteria to clean up toxic wastes and oil pollutants, remove sulfur
from coal, and monitor hazardous waste sites.</div>
<div class="MsoNormal">
<br /></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg84dA4U8Ixbw_GXfo-aslmohqiYDyDZPWIZGZVfmNBcyFmzAQQA7XsuJJ8Pe4JQzBJDOQwPoPF3EbiV-HtYuVeAW_Lqh1EmWB61uSUInFo3a5AiW8nn8R1lFXuA5GtlOkI0gHi1TiyBlUl/s1600/cornpharma.JPG" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="119" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg84dA4U8Ixbw_GXfo-aslmohqiYDyDZPWIZGZVfmNBcyFmzAQQA7XsuJJ8Pe4JQzBJDOQwPoPF3EbiV-HtYuVeAW_Lqh1EmWB61uSUInFo3a5AiW8nn8R1lFXuA5GtlOkI0gHi1TiyBlUl/s200/cornpharma.JPG" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Cornpharma / wa.greens.org.au / accessed 3/8/12</td></tr>
</tbody></table>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b>Transgenic plants: more vitamins and better pest resistance</b></span></div>
<div class="MsoNormal">
Genetic engineering has produced tomato plants that resist
freezing, crops that are resistant to insects, and herbicides. Transgenic
plants are being used to produce edible vaccines against infectious disease and
they can even be made to produce human proteins. There are some concerns
however in regards to safety as well as concerns about crop failures.</div>
<br />
<div class="separator" style="clear: both; text-align: center;">
</div>
<br />
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi3NtBS0qnrFPOQI0zMfa-OUGrnQKbowH_gjBTbHwCL4auAjMB3tctvVrc8gCmddgtVuWOtFTpPNhFOrIciLS0LcEnJXfdq4spwbJbixlIIdLVeJcPswjNxzGF7cXsNAhoARcSLq_OrixWi/s1600/GeneticEngineering.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="165" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi3NtBS0qnrFPOQI0zMfa-OUGrnQKbowH_gjBTbHwCL4auAjMB3tctvVrc8gCmddgtVuWOtFTpPNhFOrIciLS0LcEnJXfdq4spwbJbixlIIdLVeJcPswjNxzGF7cXsNAhoARcSLq_OrixWi/s200/GeneticEngineering.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Genetic Engineering / watermarked.cutcaster.com /</td><td class="tr-caption" style="text-align: center;"> accessed 3/8/12</td></tr>
</tbody></table>
<div class="MsoNormal" style="color: purple;">
<br />
<br />
<span style="font-size: small;"><b>Transgenic animals: a bigger challenge</b></span></div>
<div class="MsoNormal">
Producing transgenic animals has proven to be the more
difficult of all the processes. The number of animals that can be produced at
one time is very limited. But despite the drawbacks, production is moving
forward for use in food production and to study human disease. Pharmaceutical
companies are also inserting genes into goats, sheep and cows for human protein
production. This<br />
process of producing proteins from farm animals is termed gene
farming.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<span style="font-size: small;"><b>Gene Therapy: The Hope of
the Future?</b></span></div>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b>Gene therapy must overcome many obstacles</b></span></div>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj2ODUSdmwuPUB1N2lY-qUW6yF502mV0LUsGH0-SupKikbA4ANxCibDBUaDkHEuvUpMbWW1Bi7qhHgBFNDXv9OoEyQFXiIQopCHkcfCWtGgsRwefZ2efYT-Bh1td5c_T-xxYCQ-ydv-aLpt/s1600/Genetherapy.jpg" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="149" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj2ODUSdmwuPUB1N2lY-qUW6yF502mV0LUsGH0-SupKikbA4ANxCibDBUaDkHEuvUpMbWW1Bi7qhHgBFNDXv9OoEyQFXiIQopCHkcfCWtGgsRwefZ2efYT-Bh1td5c_T-xxYCQ-ydv-aLpt/s200/Genetherapy.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">Gene Therapy / en.wikipedia.com / accessed 3/8/12</td></tr>
</tbody></table>
<div class="MsoNormal">
The first obstacle we are faced with is getting enough of
reombinant DNA containing the gene of interest into the right cells. What is
needed is a delivery system that delivers recombinant DNA to all body cells or
to specfic tissues or cell types efficiently. This, we do not have yet. The
second challenge is that even if we could correct a specific genetic disorder
in an individual, we still do not have a way to stop the disease from being
passed on to the next generation.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b>Vectors transfer genes into human cells</b></span></div>
<div class="MsoNormal">
The strategy for correcting a disease is to get enough of
the gene into enough living cells to produce enough of the missing protein to
prevent that particular disease. There are two methods for accomplishing this
and both use vectors, or transporters, that are capable of delivering genes
into human cells. Retroviruses are the best known vectors. But they have
drawbacks also. Research is currently being done to get around some of the
issues, but are currently only in an experimental phase. </div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b>Success with SCID gives hope</b></span></div>
<div class="MsoNormal">
There was limited success in treating SCID, severe
immunodeficiency disease, back in 1990. Genetically engineered T cells were
reintroduced back into a human body and ADA was produced. Ashanthi DeSilva’s
condition improved, but it was short lived and her treatments had to be
supplemented with regular doses of ADA. Approximately 10 years later, there are
finally SCID patients that have been treated successfully with gene therapy,
without any other treatment required.</div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal" style="color: purple;">
<span style="font-size: small;"><b>Research targets cystic fibrosis and cancer</b></span></div>
<div class="MsoNormal">
There has been limited success in treating cystic fibrosis
with a gene therapy administered via a nasal spray, but not enough to prevent
the disease. Research is being done to find better delivery vectors. They are
also working on targeting certain types of cancer and we may have several
promising approaches very soon. It is one thing to have gene therapy of somatic
cells that target specific disease in specific individuals. It will be another
matter entirely to have gene therapy that targets germ cells that lead to sperm
and egg. This would drastically affect future generations and brings up legal,
moral, and ethical issues that we need to be dealing with now. To read more on the controversy go to </div>
click on the link: <a href="http://www.ucsusa.org/food_and_agriculture/science_and_impacts/science/pharma-and-industrial-crops.html" target="_blank">http://www.ucsusa.org/food_and_agriculture/science_and_impacts/science/pharma-and-industrial-crops.html</a><br />
<br />
<br />
<br />Vickihttp://www.blogger.com/profile/06412364992060613157noreply@blogger.com0tag:blogger.com,1999:blog-7781582437417706765.post-58437365647813737332012-02-11T20:53:00.000-08:002012-02-11T20:53:09.995-08:00Lab Project: <b>Milk</b>, Juice, Carrot<br />
<br />
<b>Introduction</b>: We are to take 1/2 cup of milk, pour it into a jar or glass and put it into a warm, dark place for two days. We are to observe any changes in the milk due to biological influences. Proteins are critical as well as the fermentation process and carbohydrates. <br />
<br />
<b>Hypothesis</b>: I believe the bacteria in the milk, once the temperature gets warmer, will start to grow. First the milk will turn sour or ferment and eventually it will get clumpy. If enough time passes, we would eventually see mold. But I do not believe that will happen this quickly.<br />
<br />
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgU90vXmxHDLgTe9o5L0RsMdi_eKNq14zLuvYtds0Qj-AR_4ds4P3sUyPuJ88zajZRrgfLhWsSCLgJqX44Gbv7NUypqkdWReCb82Zi2rPP5cKnCspNtRoi67RDuhA8VxD12LLMixJYvPv6Z/s1600/1st+milk+pic.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="150" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgU90vXmxHDLgTe9o5L0RsMdi_eKNq14zLuvYtds0Qj-AR_4ds4P3sUyPuJ88zajZRrgfLhWsSCLgJqX44Gbv7NUypqkdWReCb82Zi2rPP5cKnCspNtRoi67RDuhA8VxD12LLMixJYvPv6Z/s200/1st+milk+pic.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">1/2 cup of milk</td></tr>
</tbody></table>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjO7DZZcI9eQLz_FofvE6HbS6uOAWArgRENPranAS-adfD6alCMgq7zwIgRctfTnug67j5Uq40WATpQiLmJMvkCi6yLC26aM1npvMiIjuJ0vbzfAywWc22LvPSMxoQaQW2-hHw7xYOaoslw/s1600/2nd+milk+pic.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="150" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjO7DZZcI9eQLz_FofvE6HbS6uOAWArgRENPranAS-adfD6alCMgq7zwIgRctfTnug67j5Uq40WATpQiLmJMvkCi6yLC26aM1npvMiIjuJ0vbzfAywWc22LvPSMxoQaQW2-hHw7xYOaoslw/s200/2nd+milk+pic.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">milk in glass</td></tr>
</tbody></table>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEh2UYc3ttQ76_0Wl8zJ5q_gnW05k6FzjjgFuIXi_3Vl3T8b7R8ya_kzg9F9r_t5VSsKvG-AZh6A4mIZR4teZey4VNqxx8JVLUhXXCoBpTV3QeLefXY6YWd0nnyct9wInNoiXMbxhp19CsHx/s1600/milk+pic3.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="150" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEh2UYc3ttQ76_0Wl8zJ5q_gnW05k6FzjjgFuIXi_3Vl3T8b7R8ya_kzg9F9r_t5VSsKvG-AZh6A4mIZR4teZey4VNqxx8JVLUhXXCoBpTV3QeLefXY6YWd0nnyct9wInNoiXMbxhp19CsHx/s200/milk+pic3.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">milk in dark place</td></tr>
</tbody></table>
<b>Procedure</b>: I poured a 1/2 a cup of 2% milk into a small glass. I then placed it in a file cabinet and shut the drawer for a period of two days. <br />
<br />
<br />
<table align="center" cellpadding="0" cellspacing="0" class="tr-caption-container" style="margin-left: auto; margin-right: auto; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEig7SKK2lWEV-QqiziOr21bpe5nlCjnvgJuEiCNnvd8VB-ASuDl1prcAwJh8wYaElzLDyz3S_MjO7vtQ8OXUYivVgwX5_lHBgwNNOhxpbK8Ph4PP3ST3KZ-upXb66hTjwzY8e0LmInpgdA0/s1600/milk+pic4.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="150" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEig7SKK2lWEV-QqiziOr21bpe5nlCjnvgJuEiCNnvd8VB-ASuDl1prcAwJh8wYaElzLDyz3S_MjO7vtQ8OXUYivVgwX5_lHBgwNNOhxpbK8Ph4PP3ST3KZ-upXb66hTjwzY8e0LmInpgdA0/s200/milk+pic4.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">results</td></tr>
</tbody></table>
<b>Results</b>: There was film scum on the edges of the milk in the glass. It was sour to taste (I dabbed my finger into it). But no clumping yet and no mold.<br />
<br />
<b>Conclusion</b>: A conversion of carbohydrates to alcohol and sugar to lactic acid occurs. Bacteria, called coliforms exist in milk. It metabolizes or ferments sugar to gain energy in order to grow and multiply. This process will continue until there is no sugar left. Coliforms include E-Coli. (As a side note: Pastuerization reduces the level of coliforms). Once all the lactose is consumed, the bacteria breaks down the protein to form amonia (the base pH of milk). The protein in milk denatures or loses their shape and clumps form together.<br />
<br />
<br />
<br />
Lab Project: Milk, <b>Juice</b>, Carrot<br />
<br />
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhk7OPxLI5qfxSasqKw82-G6xVzkPjO3_DUkePoYyEbWp056FfrL0aAjcvcbEm7CzzWiHu8zqiKmrRRXwucy_IqkjDwc3VhQMvD6NXz4tdpYaopFoDoY09grZB_9NNBNaeBz196YNOVRwKm/s1600/1st+juice+pic.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="150" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhk7OPxLI5qfxSasqKw82-G6xVzkPjO3_DUkePoYyEbWp056FfrL0aAjcvcbEm7CzzWiHu8zqiKmrRRXwucy_IqkjDwc3VhQMvD6NXz4tdpYaopFoDoY09grZB_9NNBNaeBz196YNOVRwKm/s200/1st+juice+pic.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">1/2 cup of juice</td></tr>
</tbody></table>
<br />
<b>Introduction:</b> We are to witness the mixing action of molecules and describe the process. We take 2 cups of room temperature water, two cups of ice water and two cups of boiling water into separate cups or jars. Then we take a 1/2 cup of a dark juice and pour a third of this into each cup of water.The temperature of the water will have a definite impact on the way the molecules mix.<br />
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiLCYlsHcuU9Whyphenhyphen6tjcTKL_LnTv8y9q_AkCJ9StbtVBP0ZMkuutXpU8TnkN5MMBkBDxbRqZqqfdchmY3gFmVW1r6Zz9SzBjPGwWjwn4sggS-Z36T5lEOLD7SHT7K_XleIQVRxqQy7YG65bN/s1600/3rd+juice+pic.jpg" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="150" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiLCYlsHcuU9Whyphenhyphen6tjcTKL_LnTv8y9q_AkCJ9StbtVBP0ZMkuutXpU8TnkN5MMBkBDxbRqZqqfdchmY3gFmVW1r6Zz9SzBjPGwWjwn4sggS-Z36T5lEOLD7SHT7K_XleIQVRxqQy7YG65bN/s200/3rd+juice+pic.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">room temp juice/water</td></tr>
</tbody></table>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgAvDnjEW4sR-5zpckJuU1d8Tx3cWLedbCVsUKda1MxHGoIwLy3JoEDaq58Z0Ygl-kPFQCtfe_U8Vgvlpf_tPoxiyF-QOMxC6oZFksZJQxEHuWg29G4bxOUI-KstNHC9teovSONkE-lejeX/s1600/2nd+juice+pic.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="150" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgAvDnjEW4sR-5zpckJuU1d8Tx3cWLedbCVsUKda1MxHGoIwLy3JoEDaq58Z0Ygl-kPFQCtfe_U8Vgvlpf_tPoxiyF-QOMxC6oZFksZJQxEHuWg29G4bxOUI-KstNHC9teovSONkE-lejeX/s200/2nd+juice+pic.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">room temp water</td></tr>
</tbody></table>
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEh23SPdXp-CoDwjn-9-DBq1v5a40Tnf925twtEaXtmlEUIIO26dS_3Ohr_vTzuH_38an1mWisDJxH-Fij5zAdkwmIQzlYmJvuvkoYa99ZOnSTHGHG2P52DopWUloipk8pg1Op3gEMgUrHno/s1600/4th+juice+pic.jpg" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="150" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEh23SPdXp-CoDwjn-9-DBq1v5a40Tnf925twtEaXtmlEUIIO26dS_3Ohr_vTzuH_38an1mWisDJxH-Fij5zAdkwmIQzlYmJvuvkoYa99ZOnSTHGHG2P52DopWUloipk8pg1Op3gEMgUrHno/s200/4th+juice+pic.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">ice water/juice </td></tr>
</tbody></table>
<br />
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEixlFXIvYubG0ZApxy50FEb3VKJxcVFPNW4e-C0Ce59i1A2MkE_PpP2u5c-iwokRBhbnhOrFWD156ypD7wtlItceGiiKlHFrFSbZV_4ymocYrGOghYFFtNqasX_u15UnjKAX_BDg60jD3kR/s1600/5th+juice+pic.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="150" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEixlFXIvYubG0ZApxy50FEb3VKJxcVFPNW4e-C0Ce59i1A2MkE_PpP2u5c-iwokRBhbnhOrFWD156ypD7wtlItceGiiKlHFrFSbZV_4ymocYrGOghYFFtNqasX_u15UnjKAX_BDg60jD3kR/s200/5th+juice+pic.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">ice water/juice</td></tr>
</tbody></table>
<br />
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="clear: right; float: right; margin-bottom: 1em; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj_WoHKgCzbvpoicQG_OlRekRYUlFbhHaFWgyFWry8hQFVNwV1FSUjpSmuCkQLDLgdSUs-nVcXOU3tQED3KybSbguY6PDOO7PxRwYpl9zfJIFJNoi95OQquUMSlntBc3azdPG2UHTWOTJrZ/s1600/7th+juice+picbrokenglass.jpg" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="150" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj_WoHKgCzbvpoicQG_OlRekRYUlFbhHaFWgyFWry8hQFVNwV1FSUjpSmuCkQLDLgdSUs-nVcXOU3tQED3KybSbguY6PDOO7PxRwYpl9zfJIFJNoi95OQquUMSlntBc3azdPG2UHTWOTJrZ/s200/7th+juice+picbrokenglass.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">broken glass</td></tr>
</tbody></table>
<b>Hypothesis</b>: I believe the temperature of the water will have a serious impact on how these molecules mix. Not sure what it will do, butI think hot water will mix fairly quickly, cold probably not so muchand room temperature may not have any effect. <br />
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgsyJuFsAVQxC2QbNILiqP0bDYFH-z0q3XmzmGfF4mKccXSZ-IZc8nahL8b3wNKyFyl6v_tckBwh18G-daQJ0V3kqeA57sLs_FP6ONgvpg3Rfz7Jsw4HJeXspqCBcWGjphoWgNuCnLkuFm0/s1600/6th+juice+picboiling+water.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="150" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgsyJuFsAVQxC2QbNILiqP0bDYFH-z0q3XmzmGfF4mKccXSZ-IZc8nahL8b3wNKyFyl6v_tckBwh18G-daQJ0V3kqeA57sLs_FP6ONgvpg3Rfz7Jsw4HJeXspqCBcWGjphoWgNuCnLkuFm0/s200/6th+juice+picboiling+water.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">boiling water</td></tr>
</tbody></table>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgzwXxzBL5wCEeYJw3lQJ_NUupT0OMiCCAAEewUOQGQxqoAbWelDBkRIorKlHLfv6xZ2mmEuYCg6sAoTuQoh9qRZdcaebU3RfAOXmE8DpVzcBXDcEySLdbbsUIvw4vGpI0JekdP5pIBcvZJ/s1600/8th+juice+picnew+boilwater.jpg" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="150" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgzwXxzBL5wCEeYJw3lQJ_NUupT0OMiCCAAEewUOQGQxqoAbWelDBkRIorKlHLfv6xZ2mmEuYCg6sAoTuQoh9qRZdcaebU3RfAOXmE8DpVzcBXDcEySLdbbsUIvw4vGpI0JekdP5pIBcvZJ/s200/8th+juice+picnew+boilwater.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">boiling water/juice</td></tr>
</tbody></table>
<br />
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhOJsiB8qckT3nlczKqlcvi0U6kc8ZVKkv_7Riv9Sry38tI8DcB3D9Y8FYFL22x51Q1BOj0yFdNEzlrnVIVgoGPJTUNji79wC2RSVr853qT5ccQXp-Tfz4BaDFZ_QO1YzOKJ_JeapXHnBYv/s1600/6th+juice+picboiling+water.jpg" imageanchor="1" style="clear: right; float: right; margin-bottom: 1em; margin-left: 1em;"> </a><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhOJsiB8qckT3nlczKqlcvi0U6kc8ZVKkv_7Riv9Sry38tI8DcB3D9Y8FYFL22x51Q1BOj0yFdNEzlrnVIVgoGPJTUNji79wC2RSVr853qT5ccQXp-Tfz4BaDFZ_QO1YzOKJ_JeapXHnBYv/s1600/6th+juice+picboiling+water.jpg" imageanchor="1" style="clear: right; float: right; margin-bottom: 1em; margin-left: 1em;"> </a><b>Procedure:</b> I first poured the juice into a measuring cup. Next, I poured room temperature water into a glass and proceeded to pour a third of the juice into this glass. Next, I poured cold ice water into a glass and them followed with another third of the juice. Then, I boiled 2 cups of water and poured that into a glass, at which point the glass cracked and the water leaked out. So I had to start all over, boil more water and then poured it instead into a measuring cup and then followed this with the remaining juice.<br />
<br />
<b>Results: </b>In the room temperature water and juice combo, I did not notice much of anything. The mixture mixed fairly well, but was cloudy. When I mixed the ice water and juice, the juice sunk to the bottom and bubbles appeared on top. When I poured the boiling water into the glass, my glass cracked and all the liquid leaked out. So I redid, and poured it into a measuring cup and then added the remaining juice. Last, but not least, when I managed to combine the boiling water and juice, it mixed very quickly and was a fairly clear solution.<br />
<b> </b><br />
<b>Conclusion:</b> The room temperature water had very little effect on the mixing action of these molecules compared to the ice and boiling water. When I mixed the ice water and juice, the moving action of the molecules was very slow. When the boiling water was poured into the glass, it broke because the inner surface of the glass gets the heat first and expands more
quickly than the outside. The sudden pressure from the heated inside is so strong and sudden that the whole glass breaks. Once I managed to add boiling water and juice, the hot water caused the mixing action to speed up and molecules mixed quickly. <br />
<br />
Lab Project: Milk, Juice, <b>Carrot</b><br />
<br />
<b>Introduction</b>: The objective of the carrot lab is to investigate the cellular functions and cellular structures using a carrot in both fresh water and salt water.<br />
<br />
<b> </b><br />
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj0LYRiIgQ8w22RaDZGBH-iV3Jsz3hPzwm5R2i86NAtZjH4Ck0lIf8hqhxjZ6mq8SsQjOoe0EgozMX3grqtCsnCyEo8NoPaFUP7WQX9ger_fZUEfW1UoX0B8wX-8POUupHDTgoKaCbcirSt/s1600/1stcarrot.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="150" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj0LYRiIgQ8w22RaDZGBH-iV3Jsz3hPzwm5R2i86NAtZjH4Ck0lIf8hqhxjZ6mq8SsQjOoe0EgozMX3grqtCsnCyEo8NoPaFUP7WQX9ger_fZUEfW1UoX0B8wX-8POUupHDTgoKaCbcirSt/s200/1stcarrot.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">whole carrot</td></tr>
</tbody></table>
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiiZ_JQ-UBYaaR50b4_wYWE0sQqjb7Y0vQ8jocg1ZH92AYNr78i_ccpMBVw6ILYKUTa7m7SkvTHAzc4vI5sB36QNPSNL4Y4pn1pMPEjSZVgdy3dj9LvDkD7gkarnoFvfT_K8w46EakPNt-y/s1600/2ndccarrotpic.jpg" imageanchor="1" style="clear: right; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="150" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiiZ_JQ-UBYaaR50b4_wYWE0sQqjb7Y0vQ8jocg1ZH92AYNr78i_ccpMBVw6ILYKUTa7m7SkvTHAzc4vI5sB36QNPSNL4Y4pn1pMPEjSZVgdy3dj9LvDkD7gkarnoFvfT_K8w46EakPNt-y/s200/2ndccarrotpic.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">cut in half</td></tr>
</tbody></table>
<div class="separator" style="clear: both; text-align: center;">
<b>Hypothesis</b>: I believe that the carrot in the fresh water will swell after soaking and the carrot in the salt water will either remain the same or shrink. The fresh water will probably diffuse into the carrots cells and just the opposite with salt water.</div>
<br />
<br />
<table align="center" cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><img border="0" height="150" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhpjLJRDFaVcnQf3O5dZHVb5M_AoxsnW58l4sQhZLGd_lVAb0OlyyjtsEFfiXL10Ipqun10ygk7f5aG_Qkz27iblZU9eITcSr7UMuARrKPo4w9B5TzhU3xF4QgnisG-FWdUWE_fEpOZcnJR/s200/6thcarrotpic.jpg" style="margin-left: auto; margin-right: auto;" width="200" /></td></tr>
<tr><td class="tr-caption" style="text-align: center;">original measurement</td></tr>
</tbody></table>
<b>Procedure</b>: We were to pour two cups of water into two glasses or jars. In one cup was added a teaspoon of salt. Then I labeled them, "fresh" and "salt" respectively. I cut a carrot in half and measured both pieces in height and width. Then I tied a string around the cut end of each piece and put them into their water to soak for 24 hours. <br />
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiqWw6O9cBd-VcyFLjgb7HH916br9YOQglCyx7DMGQb7s1YvtR02AzPc6bZwM1C4Sxaf2wKCErpxTfCq2GaFJdWXeomoy2TKF50p2O-8CJUgGBLG2oSprpRrAGnGhUZanOREza0yXYhSAgI/s1600/5thcarrotpic.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="150" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiqWw6O9cBd-VcyFLjgb7HH916br9YOQglCyx7DMGQb7s1YvtR02AzPc6bZwM1C4Sxaf2wKCErpxTfCq2GaFJdWXeomoy2TKF50p2O-8CJUgGBLG2oSprpRrAGnGhUZanOREza0yXYhSAgI/s200/5thcarrotpic.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">glasses labeled</td></tr>
</tbody></table>
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhpjLJRDFaVcnQf3O5dZHVb5M_AoxsnW58l4sQhZLGd_lVAb0OlyyjtsEFfiXL10Ipqun10ygk7f5aG_Qkz27iblZU9eITcSr7UMuARrKPo4w9B5TzhU3xF4QgnisG-FWdUWE_fEpOZcnJR/s1600/6thcarrotpic.jpg" style="clear: right; float: right; margin-bottom: 1em; margin-left: 1em;"></a><br />
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;"><tbody>
<tr><td style="text-align: center;"><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjYA5C8m2uOYleDHNTx9xQ1S8yoP5fMrnVUj2GHh9nHz5Pu3pRnxP7Qyv5H0iVy6t-oq6Bom_kReshAxzGVUAK7UtJ8bDy3ngqVZYH5grSIvX7uN_o_V-HxEYbKWqclxuNURte1egzU-0Vv/s1600/8thcarrotpic.jpg" imageanchor="1" style="clear: left; margin-bottom: 1em; margin-left: auto; margin-right: auto;"><img border="0" height="150" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjYA5C8m2uOYleDHNTx9xQ1S8yoP5fMrnVUj2GHh9nHz5Pu3pRnxP7Qyv5H0iVy6t-oq6Bom_kReshAxzGVUAK7UtJ8bDy3ngqVZYH5grSIvX7uN_o_V-HxEYbKWqclxuNURte1egzU-0Vv/s200/8thcarrotpic.jpg" width="200" /></a></td></tr>
<tr><td class="tr-caption" style="text-align: center;">soaking overnight</td></tr>
</tbody></table>
<br /><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhpjLJRDFaVcnQf3O5dZHVb5M_AoxsnW58l4sQhZLGd_lVAb0OlyyjtsEFfiXL10Ipqun10ygk7f5aG_Qkz27iblZU9eITcSr7UMuARrKPo4w9B5TzhU3xF4QgnisG-FWdUWE_fEpOZcnJR/s1600/6thcarrotpic.jpg" imageanchor="1" style="clear: right; float: right; margin-bottom: 1em; margin-left: 1em;"></a><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<b>Results: </b>The initial width of the salt water carrot was 3/4" and the<br />
height was 4 11/16". After soaking for 24 hours, the width and height were the same. So the salt water maintained the carrots size. The beginning width of the fresh water carrot was 3/4" and the height was 4 5/8". After soaking 24 hours, the width was 13/16" and the height was 4 11/16". So the carrot expanded by 1/16 of an inch both in width and height. <br />
<table align="center" cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: left; margin-right: 1em; text-align: left;"><tbody>
<tr><td style="text-align: center;"><img border="0" height="150" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgjPovop5dTnuNH58XdacEyQ5MgrzoeJ2lOYVKDELKu1JZCEQdt8BYQluUEQFSeEbiAD-Z9QLL4kcL05hOmcgMd9CwWmq-LyWrxGk0DTEnbOlAz2rPnU1tL-e1syZnrpGGeUnXFQw8uO-Mv/s200/9thcarrotpic.jpg" style="margin-left: auto; margin-right: auto;" width="200" /><br />
<table cellpadding="0" cellspacing="0" class="tr-caption-container" style="float: right; margin-left: 1em; text-align: right;">
<tbody>
<tr><td style="text-align: center;"><br /></td></tr>
<tr><td class="tr-caption" style="text-align: center;">measurement afterward</td></tr>
</tbody>
</table>
<br />
</td></tr>
<tr><td class="tr-caption" style="text-align: center;"></td></tr>
</tbody></table>
<br /><br />
<b>Conclusion</b>: Osmosis is the diffusion of water through a membrane. A carrot is
made up of tiny cells surrounded by cell
membranes. The cell membrane keeps cell parts inside and protected.
While this membrane stops most things, water can pass through it. Water moves through cell membranes towards a higher concentration of
dissolved chemicals. When the carrot is soaking in salt water, the water found in the carrot's cell will move into
the salty water to equalize the amount of water inside and outside the
cells' membranes. As more and more of the cells lose water, the carrot
becomes soft and flexible. When the carrot is placed in the fresh water,
the reverse happens. The fresh water around the carrot moves into
the carrot's cells. The string will tighten and the carrot will swell with water.Vickihttp://www.blogger.com/profile/06412364992060613157noreply@blogger.com0tag:blogger.com,1999:blog-7781582437417706765.post-26380886801074570512012-02-07T11:30:00.000-08:002012-02-07T15:17:18.651-08:00<div style="text-align: left;">
<b><span style="font-size: large;">Human Biology</span></b></div>
<div style="text-align: left;">
<br /></div>
<div style="text-align: left;">
Table of Contents:</div>
<div style="text-align: left;">
<br /></div>
<div style="color: red; text-align: left;">
<a href="#Bio">Human Biology, Science, and Society</a></div>
<div style="text-align: left;">
<a href="#Life">The Characteristics of Life</a></div>
<div style="text-align: left;">
<a href="#Fit">How Humans Fit into the Natural World</a></div>
<div style="text-align: left;">
<a href="#Know">Science is Both a Body of Knowledge and a Process</a></div>
<div style="text-align: left;">
<a href="#Style">Sources of Scientific Information Vary in Style and Quality</a></div>
<div style="text-align: left;">
<a href="#Thinker">Learning to be a Critical Thinker</a></div>
<div style="text-align: left;">
<a href="#Role">The Role of Science in Society</a></div>
<div style="text-align: left;">
</div>
<br />
<span style="color: red;"><a href="#Chem">The Chemistry of Living Things</a></span><br />
<a href="#Matter">All Matter Consists of Elements</a><br />
<a href="#Atoms">Atoms Combine to From Molecules</a><br />
<a href="#Water">Life Depends on Water</a><br />
<a href="#Ions">The Importance of Hydrogen Ions</a><br />
<a href="#Organic">The Organic Molecules of Living Organisms</a><br />
<a href="#Carbs">Carbohydrates: Used for Energy and Structural Support</a><br />
<a href="#Lipids">Lipids: Insoluble in Water</a><br />
<a href="#Proteins">Proteins: Complex Structures Constructed of Amino Acids</a><br />
<a href="#Acids">Nucleic Acids Store Genetic Information</a><br />
<a href="#ATP">ATP Carries Energy</a><br />
<br />
<span style="color: red;"><a href="#Structure">Structure and Function of Cells</a></span><br />
<a href="#Class">Cells are Classified According to their Internal Organization</a><br />
<a href="#Cell">Cell Structure Reflects Cell Function</a><br />
<a href="#Plasma">A Plasma Membrane Surrounds the Cell</a><br />
<a href="#Cross">Molecules Cross the Plasma Membrane in Several Ways</a><br />
<a href="#Function">Internal Structures Carry Out Specific Functions</a><br />
<a href="#Move">Cells have Structures for Support and Movement</a><br />
<a href="#Energy">Cells Use and Transform Matter and Energy</a><br />
<br />
<span style="color: red;"><a href="#Organsys">From Cells to Organ Systems</a></span><br />
<a href="#Groups">Tissues are Groups of Cells with a Common Function</a><br />
<a href="#Epith">Epithelial Tissues Cover Body Surfaces and Cavities</a><br />
<a href="#Conn">Connective Tissue Supports and Connects Body Parts</a><br />
<a href="#Muscle">Muscle Tissues Contract to Produce Movement</a><br />
<a href="#Nervous">Nervous Tissue Transmits Impulses</a><br />
<a href="#Complex">Organs and Organ Systems Perform Complex Functions</a><br />
<a href="#Skin">The Skin as an Organ System</a><br />
<a href="#Homeo">Multicellular Organisms Must Maintain Homeostasis</a><br />
<br />
<div style="text-align: left;">
</div>
<div style="text-align: left;">
<br /></div>
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgJcJJn-YXewkqUf_APIfkI4oFw-JncAo0g5HDJN5SgV-hSKwvCjaO6EoCeUc3G-NFAVdXZ7OsCtjT0NJARFuRONPEfch0HalmGSkrXAqHDM8TDYoOYVs99hOGDApkxfs-dGC6vzdzyH3LI/s1600/babysface.JPG" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" height="200" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgJcJJn-YXewkqUf_APIfkI4oFw-JncAo0g5HDJN5SgV-hSKwvCjaO6EoCeUc3G-NFAVdXZ7OsCtjT0NJARFuRONPEfch0HalmGSkrXAqHDM8TDYoOYVs99hOGDApkxfs-dGC6vzdzyH3LI/s200/babysface.JPG" width="200" /></a></div>
<div class="separator" style="clear: both; text-align: center;">
</div>
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjICStDJuE9LAVF5IcfBJr6862MPnrLZmFe_9LDFSqOVI0E3wNvj3547JLI3-rjW4KnTY7ogyPSwB1UgcVqLdbLVSU6b3bAdfqXuKoncgevboGikaelvIj2vTuZnEMRN7wz0GW4ei8gHoBn/s1600/huddle.JPG" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" height="133" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjICStDJuE9LAVF5IcfBJr6862MPnrLZmFe_9LDFSqOVI0E3wNvj3547JLI3-rjW4KnTY7ogyPSwB1UgcVqLdbLVSU6b3bAdfqXuKoncgevboGikaelvIj2vTuZnEMRN7wz0GW4ei8gHoBn/s200/huddle.JPG" width="200" /></a><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEghhH6PwwUZIwNPTJOEeGtAz0LeM8rgn6Wjxk2xWZPXk2AiJ7adjeqgSmhcYwuEFKm7DFqOuhIfas_3bhQxjMpPw-WNrWts-q41l8HF9234tmRC3NKKrQaqm6W_IjulTpYR-NWgEK_FLOCr/s1600/chemicalstitlepg.JPG" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" height="200" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEghhH6PwwUZIwNPTJOEeGtAz0LeM8rgn6Wjxk2xWZPXk2AiJ7adjeqgSmhcYwuEFKm7DFqOuhIfas_3bhQxjMpPw-WNrWts-q41l8HF9234tmRC3NKKrQaqm6W_IjulTpYR-NWgEK_FLOCr/s200/chemicalstitlepg.JPG" width="159" /></a></div>
<span style="font-size: large;"><b><a name="Bio">Human Biology, Science, and Society</a></b></span><br />
<span style="font-size: large;"><b><br /></b></span><br />
<span style="font-size: large;"><b><span style="font-size: small;"><a name="Life">The Characteristics of Life</a></span></b></span><br />
<a href="http://www.youtube.com/watch?v=juxLuo-sH6M" target="_blank">www.youtube.com/watch?v=juxLuo-s</a><br />
<br />
(accessed 1/20/2012)<br />
<span style="background-color: #444444;"><span style="background-color: #b45f06;"></span></span><br />
I would like to encourage each one of my fellow students to take a few moments to watch this video. It is absolutely awesome! <br />
<br />
<br />
<div class="separator" style="clear: both; text-align: center;">
</div>
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiO2DvWXtHbmBpU2_W1zDjkKilvGk4FxAe56Q4lZAojOUwnCrj7CQySaHY1Gbnukue5o_PPgm-hDpa15bYWbWIqxrEZwFQDad5LLRb0Ti1k_ZW8EpFxNq7v_gq48M-hv9pjhoMtTHGMCy0R/s1600/frog.JPG" imageanchor="1" style="clear: left; float: left; margin-bottom: 1em; margin-right: 1em;"><img border="0" height="133" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEiO2DvWXtHbmBpU2_W1zDjkKilvGk4FxAe56Q4lZAojOUwnCrj7CQySaHY1Gbnukue5o_PPgm-hDpa15bYWbWIqxrEZwFQDad5LLRb0Ti1k_ZW8EpFxNq7v_gq48M-hv9pjhoMtTHGMCy0R/s200/frog.JPG" width="200" /></a>Nonliving and living things are both composed of approximately 100 different chemicals. But only a few of these are found in abundance in living organisms. Living things can also combine elements, creating molecules in unique ways. It is these molecules (proteins, carbohydrates, lipids and nucleic acids) in varying forms, that create a diversity of life.<br />
<br />
Living things require energy and raw materials. All living things take in raw materials and energy from the environment and metabolize that into the molecules and energy that are needed to survive. Plants get their energy from sunlight and chemicals from soil, water and air. Animals and all other forms of life use water, air, plants and other animals.<br />
<br />
Living things are composed of cells. Cells being the smallest unit that has all the characteristics of life. There are unicellular and multi-cellular organisms. <br />
<br />
<br />
We maintain homeostasis. Single cell organisms are encased in membranes that provide a selective barrier for fluids to exit or enter, thus maintaining a stable internal environment. In multi-cellular organisms, it is the tissues, organs and organ systems that provide that service. <br />
<br />
<a href="http://www.phys.unsw.edu.au/biosnippets/biosnippets_container2.swf">http://www.phys.unsw.edu.au/biosnippets/biosnippets_container2.swf</a> (accessed 1/20/2012)<br />
<br />
Living things respond to their external environment. For example, humans sweat when too hot to cool down their system. Plants grow towards light and even bacteria move toward nutrients. Living things grow and reproduce. This ability is determined by DNA, a genetic material in cells. There are some nonliving things that can grow larger, such as a volcanic mountain, but it cannot recreate itself. Below you will find a link to an article on just what DNA can tell us.<br />
<br />
<a href="http://www.guardian.co.uk/science/2008/apr/27/genetics.cancer">http://www.guardian.co.uk/science/2008/apr/27/genetics.cancer</a> (accessed 1/20/2012)<br />
<br />
And last but not least, populations of living things evolve. Various forms of life may change over the course of many generations. This is known as evolution. Individual organisms don’t evolve and may n<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj-_OCcoXRrsZiH8cZPaWY1cu_kOQqTx0CeFsfSjEdVSFYvIXBb52tv0M63uX-85X6GxikpUrYhSHofCbbcJVwRJFepY0miimAlWM4ThaLD4DhTxnn-VcpXPX_MZteivjtGoEKRpDHerfPd/s1600/wintertrees.JPG" style="clear: left; float: left; margin-bottom: 1em; margin-right: 1em;"><img border="0" height="132" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj-_OCcoXRrsZiH8cZPaWY1cu_kOQqTx0CeFsfSjEdVSFYvIXBb52tv0M63uX-85X6GxikpUrYhSHofCbbcJVwRJFepY0miimAlWM4ThaLD4DhTxnn-VcpXPX_MZteivjtGoEKRpDHerfPd/s200/wintertrees.JPG" width="200" /></a>ot reproduce or respond to their environment, but populations of similar organisms have the capability of doing so.<br />
image source: http://office.microsoft.com/en-us/images/results.aspx<br />
<br />
<b><a name="Fit">How Humans fit into the Natural World</a></b><br />
Living things are grouped according to their characteristics. In the five-kingdom system, one kingdom, the prokaryotes, lack nuclei. The remaining four, eukaryotes, have cell nuclei. Monera is the kingdom of bacteria. Then there is Animalia, Plantae, Fungi and Protista (consisting of algae, slime molds and protozoa). <a href="http://users.rcn.com/mnar77/pdf/Five.Kingdom.Chart.pdf">http://users.rcn.com/mnar77/pdf/Five.Kingdom.Chart.pdf</a><br />
<br />
Humans have very defining features. Opposable thumbs, large brains and bipedalism. We also have the capacity for complex language.<br />
<br />
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj-Og9rKfjYbOTLF0H_q8NJAROMqEHS2QMpdIee0c9wCqdJL555PYwF4tNdZk_eHmgt97qDe_l-nAoO-GOBDZegPo35dHVt7SmtJdAQ-qJHOK5cG3tn5Lag_WXmlEJK0hWmv7HGDshf2DKZ/s1600/MP900425337.JPG" imageanchor="1" style="clear: right; float: right; margin-bottom: 1em; margin-left: 1em;"><img border="0" height="200" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj-Og9rKfjYbOTLF0H_q8NJAROMqEHS2QMpdIee0c9wCqdJL555PYwF4tNdZk_eHmgt97qDe_l-nAoO-GOBDZegPo35dHVt7SmtJdAQ-qJHOK5cG3tn5Lag_WXmlEJK0hWmv7HGDshf2DKZ/s200/MP900425337.JPG" width="141" /></a></div>
<b><a name="Know">Science: A Body of Knowledge and a Process</a></b><br />
Information about the natural world is scientific knowledge. The scientific method is the systematic way that knowledge is acquired. <br />
<br />
Step 1: Observe and generalize<br />
Step 2: Formulate a Hypothesis<br />
Step 3: Make a testable prediction<br />
Step 4: Experiment or observe<br />
This must be a controlled experiment)<br />
Step 5: Modify your hypothesis and repeat steps 3 and 4 as necessary<br />
<br />
Of course, it does no one any good, if your findings are only known by you. The next step is to share them. Many scientists publish their findings in scientific journals.<br />
image source: http://office.microsoft.com/en-us/images/results.aspx<br />
<br />
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg0YnfoTP4kCTtWSxH-ixP1sy6eSMyQSbXICjkBVzuzSgRQ2isPWCKCQpANvk-lE4on4p1CXLGgEFZasAY_EJABdHqLHj59crfu7T7INwxhYfcmaud5cXzfT9uR_CUI5i6IQ8P7hR4xGxol/s1600/communications.JPG" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><br /></a></div>
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg0YnfoTP4kCTtWSxH-ixP1sy6eSMyQSbXICjkBVzuzSgRQ2isPWCKCQpANvk-lE4on4p1CXLGgEFZasAY_EJABdHqLHj59crfu7T7INwxhYfcmaud5cXzfT9uR_CUI5i6IQ8P7hR4xGxol/s1600/communications.JPG" style="clear: right; float: right; margin-bottom: 1em; margin-left: 1em;"><img border="0" height="143" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg0YnfoTP4kCTtWSxH-ixP1sy6eSMyQSbXICjkBVzuzSgRQ2isPWCKCQpANvk-lE4on4p1CXLGgEFZasAY_EJABdHqLHj59crfu7T7INwxhYfcmaud5cXzfT9uR_CUI5i6IQ8P7hR4xGxol/s200/communications.JPG" width="200" /></a><b><a name="Style">Sources of Scientific Information vary in Style and Quality</a></b><br />
As mentioned earlier, scientists generally communicate with one another via scientific journals like Science or Nature. But these are usually too technical for the layman. Science magazines and nonfiction books are helpful for those who would like to delve a little deeper but do not have a scientific background. Other sources include news magazines and your daily newspaper.<br />
<br />
The two newest sources are television channels such as the Documentary channel and the World Wide Web. But it must be noted that not all information on the web is accurate. You must read it with a note of caution until you can verify the information.<br />
<br />
<b><a name="Thinker">Learning to be a Critical Thinker</a></b><br />
Below are some tips on developing and/or improving your critical thinking:<br />
<ul><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEh-xFyAXmNcJ-Cdai0MJVkqd9yt_AuQqMG1FPhSwbLJj7bQuEPALcbsZDGlDgeuylTE5R0qJSOb2L2Sfft-9bqflrh1DcRzlYzsDj_1yxn0fmj0azf4nDWFDV5y3d1Jt9GRvBOpiK52unYG/s1600/criicalthinker.JPG" imageanchor="1" style="clear: left; float: left; margin-bottom: 1em; margin-right: 1em;"><img border="0" height="200" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEh-xFyAXmNcJ-Cdai0MJVkqd9yt_AuQqMG1FPhSwbLJj7bQuEPALcbsZDGlDgeuylTE5R0qJSOb2L2Sfft-9bqflrh1DcRzlYzsDj_1yxn0fmj0azf4nDWFDV5y3d1Jt9GRvBOpiK52unYG/s200/criicalthinker.JPG" width="142" /></a>
<li>Become a skeptic - question everything.</li>
<li>Appreciate statistical value - use statistics to decide how much to believe or not believe the information.</li>
<li>Learn how to read graphs - it can be worth a thousand words.</li>
<li>Know the difference between scientific evidence and anecdotes - anecdotes are not based on empirical evidence.</li>
<li>Separate fact from conclusions - a fact is verifiable, while a conclusion is a judgment based on facts. </li>
<li>Understand the difference between correlation and causation - just because something has a close relationship to another thing does not mean that the one thing caused the other.</li>
</ul>
<div class="separator" style="clear: both; text-align: center;">
</div>
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgumg6nORv5_m-xk6Xqfuyy89-nHmwTfGoJ7rzyRKnqPo-kAeHFVcKyn5qIL7oPSmyesgdDnh3_Y4E93Hinpoz2cGmm8MIcoTG41H9j4MtXbr4TeMC-qGhTfx7LiRXB3sovZBWhGmXR7QMq/s1600/bible.JPG" imageanchor="1" style="clear: right; float: right; margin-bottom: 1em; margin-left: 1em;"><img border="0" height="200" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgumg6nORv5_m-xk6Xqfuyy89-nHmwTfGoJ7rzyRKnqPo-kAeHFVcKyn5qIL7oPSmyesgdDnh3_Y4E93Hinpoz2cGmm8MIcoTG41H9j4MtXbr4TeMC-qGhTfx7LiRXB3sovZBWhGmXR7QMq/s200/bible.JPG" width="159" /></a>http://office.microsoft.com/en-us/images/results.aspx<br />
<br />
<b><a name="Role">The Role of Science in Society</a></b><br />
Science improves our human physical condition and technology - examples would be better weather predictions, in some cases saving many lives; better health care; and saving our planet.<br />
<br />
Science is limited to physical explanations for events we can observe in our world. It cannot prove or disprove anything outside of that natural world. For instance, anything pertaining to faith or ethical decisions, to name a few. <br />
<br />
We, as a society, must learn how to make informed choices. With the knowledge we now have available today, comes a great deal of responsibility. “When I was a child, I used to speak as a child, think as a child, reason as a child; when I became a man, I did away with childish things”. (1 Cor. 13:11, NAS)<br />
<br />
<b><span style="font-size: large;"><a name="Chem">The Chemistry of Living Things</a></span></b><br />
Chemistry is the science of matter, covering chemical reactions, structure, composition and properties. It is sometimes called “the central science”, because it connects physics with other natural sciences such as biology and geology.<br />
<br />
Chemistry can be traced back to alchemy, which has been practiced for millennia, especially in the Middle East. Let us now consider how the laws of chemistry promote life.<br />
<br />
<b><a name="Matter">All Matter Consists of Elements</a></b><br />
Matter is anything that has mass and occupies space and it is composed of elements. An element is the true form of matter that cannot be broken down to anything simpler. <br />
<br />
Atoms are the smallest unit in an element. We know that atoms can be split apart ie… a nuclear reaction, but they are the smallest units of matter in a chemical reaction. The nucleus or center of the atom is made up of particle protons which are positively charged and neutrons, which are neutral. <br />
<br />
Isotopes are atoms that have either more or less neutrons than the usual number for that element. The isotopes that are unstable are called radioisotopes, of which there are many. They give off energy (radiation) and particles until they become more stable. Measuring radioisotopes is the means used to determine when rocks and fossils were formed.<br />
<br />
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjmkGtep3rCW_BHx6JF9LJ7nFZJE7jwbBT3WS6947I9AOMzy3ULgOULLRMEahN45pcV3x40h4tAvATGW8u9hh16CiBkxlmLX3c9JFcKMMm9vS8hw-l4gvmz_eZVSUpAO3P7zhy-Z4ZypR45/s1600/biopic.JPG" imageanchor="1" style="clear: left; float: left; margin-bottom: 1em; margin-right: 1em;"><img border="0" height="200" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjmkGtep3rCW_BHx6JF9LJ7nFZJE7jwbBT3WS6947I9AOMzy3ULgOULLRMEahN45pcV3x40h4tAvATGW8u9hh16CiBkxlmLX3c9JFcKMMm9vS8hw-l4gvmz_eZVSUpAO3P7zhy-Z4ZypR45/s200/biopic.JPG" width="154" /></a><br />
<b><a name="Atoms">Atoms Combine to Form Molecules</a></b><br />
Energy is life’s fuel, if you will, allowing the capacity to cause change. Both breaking up molecules and joining them require energy. There is potential energy, which lays dormant and kinetic energy, which is in motion.<br />
<br />
Chemical bonds link atoms to form molecules. The three main types are ionic, hydrogen and covalent. <br />
<br />
An ionic bond takes place between opposite charged ions. Hydrogen bonds are weak and form between polar molecules. And last, but not least, covalent bonds share electrons. Covalent bonds are the strongest chemical bonds in nature. <br />
<br />
Living organisms contain only certain elements. Even though there are close to 100 elements in nature, living organisms are only made of a few. For instance, our human bodies are mainly constructed of 6 elements: oxygen, hydrogen, carbon, nitrogen, calcium and phosphorus.<br />
<br />
<br />
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhT9fjsObBmgU3dN6V4M7-ojAWSoZnWaJndQ4xkI1_vwQW-hXmAMe47kMBqIKaHm1yTPE-rAUZ2_cEWFm90DLHmvvZGcGzd2MGKpxgGowN1w_uQaJZa1pofaSzQKkOWaf8-oibSsAwL5ASw/s1600/waves.JPG" imageanchor="1" style="clear: right; float: right; margin-bottom: 1em; margin-left: 1em;"><img border="0" height="133" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhT9fjsObBmgU3dN6V4M7-ojAWSoZnWaJndQ4xkI1_vwQW-hXmAMe47kMBqIKaHm1yTPE-rAUZ2_cEWFm90DLHmvvZGcGzd2MGKpxgGowN1w_uQaJZa1pofaSzQKkOWaf8-oibSsAwL5ASw/s200/waves.JPG" width="200" /></a><b><a name="Water">Life Depends on Water</a></b><br />
Water is the most important molecule in existence. Some of the most critical properties being that it has polar molecules, is a liquid at body temperature and can absorb and hold heat. Water is the biological solvent, meaning it is a liquid that can dissolve other substances. Because water is a liquid at body temperature, it is ideal for transporting solutes from one area to another. And because of its ability to hold heat, it helps to maintain body temperature when there are changes in the environment or metabolism.<br />
<br />
<b><a name="Ions">The Importance of Hydrogen Ions</a></b><br />
Hydrogen is a single proton without an electron. Acids give up hydrogen ions, while bases accept them. When combined, they neutralize each other. We use the pH scale to measure hydrogen ion strength in a solution. Ranging from 0-14, with 7.0 being neutral. A buffer is critical in maintaining homeostasis of pH in our bodies. In our blood and urine, buffers are paired and have opposite effects.<br />
<br />
<b><a name="Organic">The Organic Molecules of Living Organisms</a></b><br />
Organic molecules contain carbon and other elements and are held together by covalent bonds. Carbon is fairly rare in our natural world (only .03% of earths crust). But living organisms actually accumulate it. It is the foundation for all organic molecules.<br />
<br />
Macromolecules are synthesized and broken down within cells. Organic molecules are created by dehydration synthesis, which requires energy. This enables new cell membranes, muscle fibers and other tissues to form. Hydrolysis is the process that breaks down macromolecules. Being the opposite of dehydration synthesis, the process releases energy.<br />
<br />
<b><a name="Carbs">Carbohydrates Are Used for Energy and Structural Support</a></b><br />
Monosaccharide (or one sugar), is the simplest carbohydrate. It is a source of quick energy. Ribose, glucose, fructose and deoxyribose are the most important monosaccharides in humans. <br />
<br />
Oligosaccharides consist of short strings of monosaccharides and are linked together by dehydration synthesis. <br />
<br />
Polysaccharides are complex carbohydrates made up of thousands of monosaccharides. Polysaccharides are the way in which cells store energy. In plants it is done through starch and in humans it is through glycogen.<br />
<br />
<b><a name="Lipids">Lipids are Insoluble in Water</a></b><br />
The most important subclasses of lipids in our bodies are triglycerides, phospholipids and steroids. Triglycerides are stored in adipose tissue and are a source of stored energy. Phospholipids are the main component of cell membranes and are a modified form of lipid. Just like triglycerides, their backbone, if you will, is made of glycerol. But they only have two fatty acid chains instead of three. There is also either a negatively charged or positively charged phosphate present. Steroids do not look the same as a lipid, but are classified as one because they are fairly insoluble in water. One of these is cholesterol, which we are all familiar with. Cholesterol is a structural component of animal cells and is the source of estrogen and testosterone. <b> </b><br />
<div class="separator" style="clear: both; text-align: center;">
</div>
<div class="separator" style="clear: both; text-align: center;">
</div>
<div class="separator" style="clear: both; text-align: center;">
</div>
<div class="separator" style="clear: both; text-align: center;">
</div>
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjRCl8U8sRdahB6LlSUQJPyiR2eCpPe6eSfcG7yKnDcghiTECRmMFXA69H_t3kF4i3NynYxkWQqWiEiBneRnMunNdTM2d7elL31L0VsqM7ntPYYdDZfmQ3rMr-ntaKJenb1hpp9P2UKGmk4/s1600/DNA.JPG" imageanchor="1" style="clear: left; float: left; margin-bottom: 1em; margin-right: 1em;"></a><br />
<br />
<br />
<b><a name="Proteins">Proteins are Complex and Constructed of Amino Acids</a></b><br />
The proteins structure, which is three-dimensional, depends on the amino acid sequence. They are created by dehydration synthesis just like carbohydrates and fats. The human body has thousands of proteins, all constructed of only 20 amino acids, with thousands of functions.<br />
<br />
An enzyme is a protein that acts as a catalyst. It speeds up the rate of a chemical reaction without being consumed. Some break molecules apart and others join them together. Without enzymes, our bodies chemical reactions would be too slow and would not sustain life.<br />
<br />
<b><a name="Acids">Nucleic Acids Store Genetic Information</a></b><br />
Another important organic molecule is the nucleic acid, both DNA (deoxyribonucleic acid) and RNA (ribonucleic acid). DNA is the genetic material directing everything that a cell does. It is the key to life itself, controlling our growth, development and reproduction. <br />
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjRCl8U8sRdahB6LlSUQJPyiR2eCpPe6eSfcG7yKnDcghiTECRmMFXA69H_t3kF4i3NynYxkWQqWiEiBneRnMunNdTM2d7elL31L0VsqM7ntPYYdDZfmQ3rMr-ntaKJenb1hpp9P2UKGmk4/s1600/DNA.JPG" style="clear: left; float: left; margin-bottom: 1em; margin-right: 1em;"><img border="0" height="200" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjRCl8U8sRdahB6LlSUQJPyiR2eCpPe6eSfcG7yKnDcghiTECRmMFXA69H_t3kF4i3NynYxkWQqWiEiBneRnMunNdTM2d7elL31L0VsqM7ntPYYdDZfmQ3rMr-ntaKJenb1hpp9P2UKGmk4/s200/DNA.JPG" width="142" /></a><br />
RNA is responsible for carrying out the instructions of DNA and at times, regulates DNA’s activity. It contains the instructions for producing proteins. RNA is a single strand, representing a portion of one strand of DNA.<br />
<br />
<b><a name="ATP">ATP Carries Energy</a></b><br />
ATP (adenosine triphosphate) is a nucleotide and is a universal source of energy for cells. Their energy is stored in the bonds between phosphate groups. The breakdown of ATP produces ADP (adenosine diphosphate). This energy source is responsible for a wide variety of processes in both plants and animals.<br />
<br />
<b><span style="font-size: large;"><a name="Structure">The Structure and Function of Cells</a></span></b><br />
In 1674, scientists discovered living cells under a microscope. Out of this came the cell doctrine, consisting of three basic principles:<br />
<br />
1. All living things are composed of cells and cell products<br />
<br />
2. A single cell is the smallest unit that exhibits all the characteristics of life.<br />
<br />
3. All cells are formed from only preexisting cells.<br />
<br />
<b><a name="Class">Cells are Classified According to their Internal Organization</a></b><br />
Every cell has a plasma membrane as the outer layer. It encloses the material inside, consisting of water, ions, enzymes and other structures that maintain life. Living cells are either eukaryotes or prokaryotes, which is determined by the way they are organized internally.<br />
<br />
A eukaryote, meaning “true nucleus”, has three basic parts: a plasma membrane, a nucleus and cytoplasm. The cytoplasm contains everything in the cell except the nucleus. It is composed of cytosol, a gel-like fluid. Within this fluid are organelles (little organs” that carry out specialized functions.<br />
<br />
Prokaryotes. Meaning “before nucleus”, do not have a nucleus or organelles. These are bacteria in the Kingdom Monera. <br />
<br />
<b><a name="Cell">Cell Structure Reflects Cell Function</a></b><br />
Cells remain small to stay efficient, but they vary in size and shape according to their function. For example, muscle cells contain numerous mitochondria. Nerve cells are long and thin - some over 3 feet long! The cells along the kidneys are cube shaped and bound tightly together. The really amazing thing is that cells that have the same functions often look vary similar in other species. <br />
<br />
The larger a cell gets, the more inefficient it becomes. As they become larger their volume increases more than their surface area. They have to be able to obtain raw material and excrete waste.This is done only by crossing the plasma membrane.<br />
<br />
<b><a name="Plasma">A Plasma Membrane Surrounds the Cell</a></b><br />
<a href="http://is3whathappenedtoday.files.wordpress.com/2011/09/membrane.jpg">http://is3whathappenedtoday.files.wordpress.com/2011/09/membrane.jpg</a><br />
The plasma membrane is made of two layers of phospholipids, plus some cholesterol and proteins. This phospholipid bilayer is only approximately 3.5 nanometers thick, way to small to see in detail, even with microscopes. <br />
<br />
Cholesterol increases the strength of the membrane. It keeps it from becoming too rigid or too flexible. Cholesterol also anchors the proteins. Various proteins provide transport for molecules across the plasma membrane. Below is a link to an animation of the plasma membrane.<br />
<br />
<a href="http://www.youtube.com/watch?v=ULR79TiUj80">http://www.youtube.com/watch?v=ULR79TiUj80</a><br />
<br />
<b><a name="Cross">Molecules Cross the Plasma Membrane in Several Ways</a></b><br />
Molecules and ions cross the plasma barrier in several ways: passive transport, active transport, and endocytosis or exocytosis. <br />
<br />
Passive transport does not require any energy to be expended. It relies on diffusion. Diffusion is a random motion as molecules float around in a gas or liquid, colliding and changing direction. The plasma membrane is very selective in what substances it lets cross. The diffusion of water across a the membrane is called osmosis. Passive transport moves with the concentration gradient which is always downhill. It can diffuse through the lipid bilayer, through channels or what they call facilitated transport. With this facilitated diffusion, the molecule attaches to a protein and crosses the barrier. It in essence, hitches a ride. You can click on the link below to watch a video on passive and active transport. (You may have to copy and paste it into your browser window)<br />
<br />
<a href="http://www.youtube.com/watch?v=j5Qway4LAkk&feature=related">http://www.youtube.com/watch?v=j5Qway4LAkk&feature=related</a><br />
<br />
Active transport can go against the concentration gradient in the opposite direction as passive transport through the plasma membrane. These are active proteins again, but rather than passive transport, they require a source of energy to transport certain molecules. ATP is one of these sources. One of the most important protein pumps is that of the sodium-potassium pump, which get its energy from breaking down ATP. Both the sodium-potassium pump and isotonic extracellular fluid help maintain cell volume. <br />
<br />
Endocytosis and exocytosis move molecules in bulk. This method is used when the molecule is too large or several types of molecules need to move in bulk. Endocytosis moves material into the cell and exocytosis moves it out. <br />
<br />
Information can be transferred across the plasma membrane via receptor proteins. The information received and transmitted across the membrane causes as series of biochemical reactions even though no molecule crossed over. <br />
<br />
<b><a name="Function">Internal Structures Carry Out Specific Functions</a></b><br />
<a href="https://upload.wikimedia.org/wikipedia/commons/5/5a/Animal_cell_structure_pt.svg" target="_blank">https://upload.wikimedia.org/wikipedia/commons/5/5a/Animal_cell_structure_pt.svg</a><br />
<ul>
<li>The most prevalent organelle in a living eukaryote is the nucleus. The nucleus is the center of information for that cell, containing the DNA.</li>
<li>Ribosomes are composed of RNA and proteins. They assemble amino acids into proteins. Some ribosomes are attached to the endoplasmic reticulum and release their proteins into the folds of the reticulum.</li>
<li>The endoplasmic reticulum is the manufacturing center and synthesizes most chemical compounds along with the attached ribosomes.</li>
<li>The Golgi apparatus is the cell’s shipping center, where it refines and packages the molecules.</li>
<li>Vesicles are membrane-bound and enclose something within the cell. There are several types, each with a different purpose. There are secretory, endocytotic, peroxisomes and lysosomes.</li>
<li>Mitochondria are the organelles that provide most of the usable energy. They are responsible for creating ATP.</li>
<li>Some cells store energy in raw form, such as fat and glycogen. They are not stored in an enclosed membrane, but are awaiting delivery to the mitochondria for conversion into ATP.</li>
</ul>
<b><a name="Move">Cells have Structures for Support and Movement</a></b><br />
The structural supports for the plasma membrane include the cytoskeleton, cilia and flagella, and centrioles. The cytoskeleton is a loose structure of microtubules and microfilaments that support the cell.<br />
<br />
Cilia and flagella are hair-like and similar in structure. Flagella are found only in sperm cells and move the sperm cell from one location to another. Cilia are found on the surface of some cells and move material along with a brushing motion. They are found in airways and certain ducts.<br />
<br />
Centrioles are short and rod-like. They help with cell division, aligning and dividing genetic material of the cell.<br />
<br />
<b><a name="Energy">Cells Use and Transform Matter and Energy</a></b><br />
Living cells can release stored energy to build, store or break down other molecules to maintain life. ATP is the most readily available form of energy. The most available “fuel” for ATP is glucose. <br />
<br />
The process of ATP from glucose has four steps: glycolysis, where six-carbon glucose is split into three-carbon pyruvate; pyruvate is converted to acetyl CoA; citric acid cycle or Krebs in which acetyl CoA combines with the four-carbon fragments left over from the previous cycle to form citric acid; and then the electron transport system produces ATP. <br />
<br />
Another source of energy are fats and proteins. In our bodies, approximately 78% is stored fat, 21% stored protein, and only 1% stored glycogen. <br />
<br />
ATP requires oxygen, for the most part. Only a very small amount can be produced without oxygen by anaerobic metabolism. <br />
<br />
<a href="http://www.sciencedaily.com/releases/2012/01/120130130419.htm">http://www.sciencedaily.com/releases/2012/01/120130130419.htm</a><br />
<br />
In the above article, there have been new strides regarding the hypoxic response related to cancer metastasis and other diseases. The hypoxic response is how our bodies respond to reduced levels of oxygen. Every cell in our bodies has the ability to respond and change to available levels of oxygen. When that response is not working properly, this is how cancer spreads. Click on the link above to find out more. <br />
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj_a6Kboj00T94FOjv0lHvLq00Svdfyh5ZYEjRwZwN73p2TeGwAfyWg8jhaZd8zX_7qe4VsXaSWB3HcQtCf6JDMCLTtBQM8LeHMyUikiJ5P9iFq1xlMDOvgxTDRIFUS2jB9GaJzZxwK1LKv/s1600/contissue.JPG" imageanchor="1" style="clear: right; float: right; margin-bottom: 1em; margin-left: 1em;"></a><br />
<b><span style="font-size: large;"><a name="Organsys">From Cells to Organ Systems</a></span></b><br />
While single-celled organisms are at the mercy of their external environment; when cells join together to form tissues, organs, and organ systems, you now have a way to maintain stability. <br />
<br />
<b><a name="Groups">Tissues: Groups of Cells with Common Function</a></b><br />
Tissues are cell groups with a common function. In fact, all multicellular organisms have specialized functions, although that in itself, is not enough. They also need to be organized and work together. Tissues have four types: epithelial, connective, muscle, and nervous. <br />
<br />
<b><a name="Epith">Epithelial Tissues Cover Body Surfaces and Cavities</a></b>Layers of sheet cells, known as epithelial tissue, cover various surfaces. Two of the most well known are your skin and mouth. The inner surfaces lined with epithelial tissues are your digestive tract, bladder, the tubules of your kidneys, lungs and blood vessels. <br />
<br />
A few of these tissues are glandular epithelia. Glands synthesize and secrete some type of product. Examples being the exocrine glands that secrete saliva ,sweat, and digestive acid and endocrine<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj_a6Kboj00T94FOjv0lHvLq00Svdfyh5ZYEjRwZwN73p2TeGwAfyWg8jhaZd8zX_7qe4VsXaSWB3HcQtCf6JDMCLTtBQM8LeHMyUikiJ5P9iFq1xlMDOvgxTDRIFUS2jB9GaJzZxwK1LKv/s1600/contissue.JPG" style="clear: right; float: right; margin-bottom: 1em; margin-left: 1em;"><img border="0" height="142" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj_a6Kboj00T94FOjv0lHvLq00Svdfyh5ZYEjRwZwN73p2TeGwAfyWg8jhaZd8zX_7qe4VsXaSWB3HcQtCf6JDMCLTtBQM8LeHMyUikiJ5P9iFq1xlMDOvgxTDRIFUS2jB9GaJzZxwK1LKv/s200/contissue.JPG" width="200" /></a> glands that secrete hormones.<br />
<br />
Epithelial tissues are classified into three main types according to their shape: squamous epithelium has one or more layers of flattened cells. Cuboidal epithelium has cube-shaped cells. And columnar epithelium is tall and rectangular.<br />
<br />
Epithelial tissues are also classified by the number of cell layers in the tissue. Simple is a single layer and stratified has multiple layers.<br />
<br />
The basement membrane is a support structure beneath the epithelial tissue. It is a noncellular layer and most often is composed of connective tissue.<br />
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj8kLHM-2VhJDi-az3-IBuB4ZUVFijNV_gk_S64Jt3FnDWdSw66Z1zN6mlYBsZeC4R4-oQCuzgSU7wAbbsRcvhlv-0FpM90UqwLBhFAylycelDThcaRyFnnrnrCpCJMv953LBPqymJDbr7-/s1600/bones.JPG" imageanchor="1" style="clear: right; float: right; margin-bottom: 1em; margin-left: 1em;"></a><a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgY5eTP2I3YE1QR-YrxFBf5aqQLTEkywoMea_1O-tTKDAwCJWEOhfgXXCxxSaSXiS_4Q326tBoipJxvEN1_ZEm7ywkeeswGIiluK1PbW5xjuyVpz-_Wa3aJjnjE2vhFKwPvLisxb3EzVsPo/s1600/bloodcells.JPG" imageanchor="1" style="clear: left; float: left; margin-bottom: 1em; margin-right: 1em;"><img border="0" height="133" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgY5eTP2I3YE1QR-YrxFBf5aqQLTEkywoMea_1O-tTKDAwCJWEOhfgXXCxxSaSXiS_4Q326tBoipJxvEN1_ZEm7ywkeeswGIiluK1PbW5xjuyVpz-_Wa3aJjnjE2vhFKwPvLisxb3EzVsPo/s200/bloodcells.JPG" width="200" /></a><br />
<b><a name="Conn">Connective Tissue Supports and Connects Body Parts</a></b><br />
Connective tissue, for the most part, have very few living cells. Their strength lies in their matrix. Fibrous connective tissues give strength, elasticity, and support. They connect various body parts and have several types of fiber and cells. There are collagen fibers, made of protein and slightly flexible. Most of these also have elastic fibers coiled within. And some have reticular fibers, thinner than collagen. Last, but not least, are the fibroblasts. These are the cells that produce and secrete the proteins that make up the collagen, elastic and reticular fibers.<br />
<br />
Bone, cartilage, blood and adipose tissue are specialized connective tissues. Bone and cartilage have very few living cells. Blood cells are connective tissue because they derive from ste<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj8kLHM-2VhJDi-az3-IBuB4ZUVFijNV_gk_S64Jt3FnDWdSw66Z1zN6mlYBsZeC4R4-oQCuzgSU7wAbbsRcvhlv-0FpM90UqwLBhFAylycelDThcaRyFnnrnrCpCJMv953LBPqymJDbr7-/s1600/bones.JPG" style="clear: right; float: right; margin-bottom: 1em; margin-left: 1em;"><img border="0" height="200" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEj8kLHM-2VhJDi-az3-IBuB4ZUVFijNV_gk_S64Jt3FnDWdSw66Z1zN6mlYBsZeC4R4-oQCuzgSU7wAbbsRcvhlv-0FpM90UqwLBhFAylycelDThcaRyFnnrnrCpCJMv953LBPqymJDbr7-/s200/bones.JPG" width="142" /></a>m cells within the bone. Adipose tissue has mainly what is called adipocytes or fat cells that store fat.<br />
<br />
<b><a name="Muscle">Muscle Tissues Contract to Produce Movement</a></b><br />
Muscle tissue is made of cells tightly packed, called muscle fibers. They are specialized to contract, resulting in movement of some kind. There are three kinds of muscle tissue: skeletal, cardiac, and smooth.<br />
<ul>
<li>Skeletal muscle connects tendons and cause body parts to move.</li>
<li>The cardiac muscle is only in the heart and only has one nucleus. It is considered involuntary because it can move on its own, without any conscience thought.</li>
<li>Like the cardiac muscle, smooth muscle only has one nucleus. They surround hollow organs and tubes. And like the cardiac, is involuntary.</li>
</ul>
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg27-OyHf2K91vVXTTFRHW6cwNdfloZQsELEfusQsKGD3ftFxq7S16R-ALtkfdnpuLND4G31m8uUNFmDzB-JSSCZKgPEE6JOmKLfFLMN67U1fjZjXHBbfrja4EpIA9RwSQz3iy3L5ntGzJf/s1600/Neuron.JPG" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><br /></a></div>
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg27-OyHf2K91vVXTTFRHW6cwNdfloZQsELEfusQsKGD3ftFxq7S16R-ALtkfdnpuLND4G31m8uUNFmDzB-JSSCZKgPEE6JOmKLfFLMN67U1fjZjXHBbfrja4EpIA9RwSQz3iy3L5ntGzJf/s1600/Neuron.JPG" style="clear: left; float: left; margin-bottom: 1em; margin-right: 1em;"><img border="0" height="150" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEg27-OyHf2K91vVXTTFRHW6cwNdfloZQsELEfusQsKGD3ftFxq7S16R-ALtkfdnpuLND4G31m8uUNFmDzB-JSSCZKgPEE6JOmKLfFLMN67U1fjZjXHBbfrja4EpIA9RwSQz3iy3L5ntGzJf/s200/Neuron.JPG" width="200" /></a><b><a name="Nervous">Nervous Tissue Transmits Impulses</a></b><br />
Nervous tissue are cells that specialize in generating and transmitting electrical impulses through our bodies. They are located in the brain, spinal cord and the nerves. The neuron is the functional part that generates and transmits these electrical impulses. Glial cells surround the neurons to protect them and supply them with nutrients.<br />
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhRvfV4Le0VInauR-DRqo8R7Iz9Q0uzold7WCxZS0XtFeXBhHL1MrhH7kipqoCvYquOZtqGBsN8OgEJRNBbV6tZMujzZ3dIVHi7ivo6zxjBlRY691wrX5tuoGGz4YbQ6XVfT-vuN7sb7Dl7/s1600/organsys.JPG" imageanchor="1" style="clear: right; float: right; margin-bottom: 1em; margin-left: 1em;"><img border="0" height="200" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhRvfV4Le0VInauR-DRqo8R7Iz9Q0uzold7WCxZS0XtFeXBhHL1MrhH7kipqoCvYquOZtqGBsN8OgEJRNBbV6tZMujzZ3dIVHi7ivo6zxjBlRY691wrX5tuoGGz4YbQ6XVfT-vuN7sb7Dl7/s200/organsys.JPG" width="150" /></a><br />
<br />
<b><a name="Complex">Organs and Organ Systems Perform Complex Functions</a></b><br />
Organs are composed of two or more tissue types. Organ systems are groups of organs that come together for a broad function, for example, respiration. There are 11 organ systems in the human body. <br />
<br />
Tissue membranes are made of an epithelial layer and a layer of connective tissue. They line body cavities. The four types being serous, mucous, synovial and cutaneous membranes.<br />
<br />
When we speak of body parts, we are divided into three planes: midsagittal, frontal, and transverse. The planes are divided further into left and right, front and back, and top and bottom.<br />
<br />
<b><a name="Skin">The Skin as an Organ System</a></b><br />
The integumentary system is made of skin, hair, nails, and glands. It protects from dehydration and injury, is a defense against bacteria and viruses, regulates body temperature, synthesizes vitamin D, and provides sensation. The skin has two layers, the epidermis - the outer layer of epithelial tissue, and dermis - the inner layer of connective tissue. Also included in the dermis is hair, smooth muscle, sebaceous glands, sweat glands, blood vessels, and sensory nerve endings.<br />
<br />
<b><a name="Homeo">Multicellular Organisms Must Maintain Homeostasis</a></b><br />
Homeostasis is the relative constancy of conditions within the internal environment. It is maintained by a negative feedback system. This meaning that it has a controlled variable, a sensor (receptor), a control center, and an effector (corrects any imbalance). It is called negative feedback because any change in the controlled variable sets off a series of events that opposes the initial change and returns it to “normal”.<br />
<br />
One of the best examples of negative feedback at work is the bodies ability to maintain a core body temperature. The variable is your core temperature, the sensors are in your skin and internal organs, the control center is your hypothalamus and the effector used is either nerve impulses that constrict blood vessels to reduce heat loss or stimulate skeletal muscles to contract, which causes shivering, which generates heat.<br />
<br />
Positive feedback systems are fairly uncommon in living organisms. Childbirth being one process that uses positive feedback. However, positive feedback does not maintain homeostasis.<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />Vickihttp://www.blogger.com/profile/06412364992060613157noreply@blogger.com1